High genomic complexity is linked to poor prognosis in chronic lymphocytic leukaemia (CLL), but its independent prognostic value remains uncertain amid emerging biomarkers. We analysed copy number alterations (CNA) in 495 treatment-naïve patients from three randomized trials (CLL4, ADMIRE, ARCTIC), incorporating IGHV status, telomere length (TL), targeted sequencing, and DNA-methylation subtypes. Patients harboured low (LGC, 0-2 CNAs; n=334), intermediate (IGC, 3-4 CNAs; n=97), or high (HGC, >5 CNAs; n=64) genomic complexity. U-CLL (81%, p<0.001) and short TL (61%, p<0.05) were enriched in HGC, and TL inversely correlated with CNA burden (τ=-0.147, p<0.001). 62% of HGC patients were n-CLL. TP53 dysfunction was associated with HGC (36%, p<0.001). Trisomy 12 and NOTCH1 mutations, were enriched in LGC (p<0.001). HGC predicted shorter progression-free and overall survival in all univariate models but only remained independently prognostic for OS only in CLL4 (HR=1.61, p=0.02). Of 64 HGC patients, 23 had TP53 dysfunction; 92% of TP53 wild-type cases had other high-risk features (TL-S, U-CLL, or n-CLL). HGC is associated with adverse outcomes but may reflect underlying biological risk rather than serve as an independent biomarker. Its interplay with telomere attrition, immunogenetics, and epigenetic subtype warrants further validation in targeted therapy-treated cohorts. ### Competing Interest Statement The authors have declared no competing interest. ### Funding Statement This study was funded by funded by Bloodwise (11052, 12036), the Kay Kendall Leukaemia Fund (873), Cancer Research UK (ECRIN-M3 accelerator award C42023/A29370, Southampton Experimental Cancer Medicine Centre grant C24563/A15581, Cancer Research UK Southampton Centre grant C34999/A18087, and programme C2750/A23669) and the Bournemouth Leukaemia Fund. The LRF CLL4 trial was funded by a core grant from Leukaemia and Lymphoma Research. Patient material was obtained from the UK CLL Trials Biobank, University of Liverpool, which is funded by Blood Cancer UK. ME acknowledges the support by The Arbib Charitable Fund. LC received a PhD studentship funded by Cancer Research UK and the Medical Research Council. The Baird lab is funded by Cancer Research UK programme C17199/A29202. ### Author Declarations I confirm all relevant ethical guidelines have been followed, and any necessary IRB and/or ethics committee approvals have been obtained. Yes The details of the IRB/oversight body that provided approval or exemption for the research described are given below: The Somerset Regional Ethics Committee for the University of Southampton gave ethical approval for this work I confirm that all necessary patient/participant consent has been obtained and the appropriate institutional forms have been archived, and that any patient/participant/sample identifiers included were not known to anyone (e.g., hospital staff, patients or participants themselves) outside the research group so cannot be used to identify individuals. Yes I understand that all clinical trials and any other prospective interventional studies must be registered with an ICMJE-approved registry, such as ClinicalTrials.gov. I confirm that any such study reported in the manuscript has been registered and the trial registration ID is provided (note: if posting a prospective study registered retrospectively, please provide a statement in the trial ID field explaining why the study was not registered in advance). Yes I have followed all appropriate research reporting guidelines, such as any relevant EQUATOR Network research reporting checklist(s) and other pertinent material, if applicable. Yes All data produced in the present study are available upon reasonable request to the authors

The presence of TP53 aberrations ( TP53ab) and/or unmutated IGHV genes (U-CLL) helps select initial treatment for CLL patients (Hallek 2018 & Walewska 2022). However, many other biomarkers identified in recent years have failed to impact clinical decisions due to their coexistence with poor-risk indicators and uncertainty in their predictive abilities, often without suitable validation in long-term Phase II/III trials with comprehensive molecular analysis. We evaluated the clinical significance of two biomarkers, DNA methylation-based epitype (DME) and telomere length (TL), in (immuno-)chemotherapy clinical trials using samples from UKCLL4 (n=304) and ARCTIC/ADMIRE (ARC/ADM) (n=215). To our knowledge, DME and TL have not been assessed in a single study. Therefore, we utilized previously published DME (Wojdacz, 2019) and TL data (Strefford, 2015 & Norris, 2019), supplemented with new MMQ-PCR data (n=60). TL cut-offs of short (TL-S, <2.92kb), intermediate (TL-I, 2.92-3.57kb), and long (TL-L, >3.57kb) and DME classifications of n-CLL (naive B-cell-like), i-CLL (intermediate B-cell-like) and m-CLL (memory B-cell-like) were employed. 73% of m-CLL and 50% of n-CLL patients harboured TL-L and TL-S, respectively (p<0.001, Figure 1). Additionally, n-CLL and TL-S were associated with poor-risk indicators, such as TP53ab and del(11q) (p<0.05, Figure 1). We then assessed the impact of 10 clinico-biological features, including DME, TL, age and treatment arm, on progression-free survival (PFS) and overall survival (OS) in CLL4 and ARC/ADM cohorts using univariate analysis (UA). The n-CLL group exhibited the shortest PFS and OS in the ARC/ADM cohort (PFS hazard ratio (HR):4.47, 95% confidence interval (CI):2.56-7.82 & OS HR:3.95, CI:1.66-9.35, p<0.01), greater than the presence of TP53ab (PFS HR:4.39, CI:2.69-7.17 & OS HR:3.77, CI:1.94-7.33, p<0.001). In CLL4, whilst TP53ab was the strongest predictor of PFS and OS (PFS HR:3.61, CI:2.39-5.44 & OS HR: 3.66, CI:2.4-5.57, p<0.001), both n-CLL (PFS HR:1.96, CI:1.32-2.9 & OS HR:2.8, CI:1.81-4.34, p<0.001) and TL-S (PFS HR:2.36, CI:1.7-3.29 & OS HR:2.66, CI:1.87-3.76, p<0.001) were in the top five predictors of PFS and OS along with U-CLL and biallelic ATM inactivation ( biATM). Next, we performed Kaplan-Meier subgroup analysis, investigating DME in TL subgroups and vice versa. Examination of both biomarkers in the opposing subgroups in the ARC/ADM cohort, showed that TL could further stratify the i-CLL subgroup, with TL-L predicting longer PFS (median:6.12 years) compared to TL-S (HR:5.78, CI:2.34-14.33, median:3.8 years, p<0.001) or TL-I (HR:3.29, CI:1.4-7.76, median:4.35 years, p<0.01). As this pairwise analysis suggested that DME and TL may differentially contribute to outcome, we performed a multivariate cox regression, whilst controlling for confounding variables such as TP53ab and U-CLL. Covariates that were significant in UA were included in a stepwise backwards elimination process until a final model was reached. The CLL4 models were based on 246 subjects with 221 PFS and 205 OS events, ARC/ADM models were based on 138 and 176 subjects with 86 and 45 events for PFS and OS, respectively. For PFS models, TL-S emerged as significant (CLL4 HR:2.14, CI:1.39-3.3, p<0.001 & ARC/ADM HR:2.18, CI:1.17-4.05, p<0.01) with a HR lower than TP53ab (CLL4 HR:3.38, CI:2.13-5.37 & ARC/ADM HR:4.94, CI:2.58-9.48, p<0.001). DME emerged as significant for PFS in the CLL4 cohort (n-CLL HR:2.35, CI:1.37-4.05, p<0.01), along with SF3B1 mutation and treatment arm (Figure 2). In ARC/ADM, U-CLL, TP53ab, TL-S, del11q and biATM emerged as significant predictors of PFS (Figure 2). For OS, in both cohorts, TP53ab (CLL4 HR:2.77, CI:1.74-4.4, p<0.001 & ARC/ADM HR:3.28, CI:1.64-6.55, p<0.001) and DME (CLL4 HR:2.07, CI:1.15-3.73, p<0.05 & ARC/ADM, HR:3.4, CI:1.14-10.12, p<0.05) were found to predict shorter survival (Figure 2). Currently, we are integrating additional IGHV/IGLV data into our analysis, including the presence of IGLV3-21R110. In conclusion, by assessing the individual contribution of DME and TL to disease survival, we found that both variables offer valuable independent prognostic information when included in statistical models with poor-risk genomic lesions. TL and DME could help identify IGHV-mutated patients destined to respond poorly to (immuno-)chemotherapy, that might be more favourably treated with targeted agents.

A significant body of literature has been generated related to the detection of measurable residual disease (MRD) at the time of achieving complete remission (CR) in patients with hairy cell leukemia (HCL). However, due to the indolent nature of the disease as well as reports suggesting long-term survival in patients treated with a single course of a nucleoside analog albeit without evidence of cure, the merits of detection of MRD and attempts to eradicate it have been debated. Studies utilizing novel strategies in the relapse setting have demonstrated the utility of achieving CR with undetectable MRD (uMRD) in prolonging the duration of remission. Several assays including immunohistochemical analysis of bone marrow specimens, multi-parameter flow cytometry and molecular assays to detect the mutant BRAF V600E gene or the consensus primer for the immunoglobulin heavy chain gene (IGH) rearrangement have been utilized with few comparative studies. Here we provide a consensus report on the available data, the potential merits of MRD assessment in the front-line and relapse settings and recommendations on future role of MRD assessment in HCL.

Key Points Cladribine is regarded as the first treatment of choice for symptomatic hairy cell leukemia. This large international study reports a complete response in 72% of cases and a continuous complete response in 20% of patients.

Hairy cell leukemia (HCL) is a rare lymphoproliferative disorder, comprising only 2% of all leukemias. The Hairy Cell Leukemia Foundation (HCLF) has developed a patient data registry to enable investigators to better study the clinical features, treatment outcomes, and complications of patients with HCL. This system utilizes a centralized registry architecture. Patients are enrolled at HCL Centers of Excellence (COE) or via a web-based portal. All data are de-identified, which reduces regulatory burden and increases opportunities for data access and re-use. To date, 579 patients have been enrolled in the registry. Efforts are underway to engage additional COE’s to expand access to patients across the globe. This international PDR will enable researchers to study outcomes in HCL in ways not previously possible due to the rarity of the disease and will serve as a platform for future prospective research.

Introduction. Cladribine is regarded as the first treatment of choice of symptomatic hairy cell leukemia (HCL) patients, as it is able to provide high rates of response and very long duration of remission in some cases. Methods. Disease-specific patients records have been reviewed at four European centers of excellence in the treatment of HCL (Bologna, Italy; Caen, France; London, United Kingdom, and Lodz, Poland) and all patients requiring treatment who received frontline cladribine have been extrapolated for analysis. Responses have been classified according to the Consensus Resolution Criteria published in 1987. The main study objectives were represented by long-term overall survival (OS), disease-free survival (DFS) and progression-free survival (PFS) rates. PFS calculation involved all patients obtaining at least a partial response; DFS was determined only in patients with a complete response (CR) after treatment. Determining events for DFS and PFS were disease progression (decline in hematologic parameters, reappearance of marrow infiltration and/or organomegaly), initiation of a subsequent treatment, death for any cause. Results. Three hundred and eighty-four HCL patients (including 3 patients with HCL variant) have been diagnosed and followed between 1969 and 2018, and all of them received frontline cladribine (either subcutaneously or intravenously, according to era- and site-specific guidelines and experience). A CR was obtained in 150 cases (39.1%), a partial response in 50 (13.0%) and a minor response in 7 (1.8%). Two hundred and eight patients (54.2%) received no further therapy besides cladribine as they did not require further treatment for their disease. A continuous CR was documented in 76 patients (19.8%), at a median follow-up period of 8.5 years (range, 1-22 years). Median OS was reached at 25.0 years, with 48.3% of patients being alive at 28 years. Median PFS was 13.0 years, with 43% of patients being free of progression at 22 years. DFS was 26.5% at 22 years, with median reached at 11 years (Figure). Retreatment with cladribine in relapsed patients occurred in 106 cases. Keywords: Lymphoid Cancers - Other No conflicts of interest pertinent to the abstract.

Causes of death, in particular deaths due to infection, have not been widely studied in randomised trials in chronic lymphocytic leukaemia. With long-term follow-up (median 13 years) we examined the cause of death in 600/777 patients in the LRF CLL4 trial. Blood samples, taken at randomisation from 499 patients, were available for identifying gene mutations. Infection was a cause of death in 258 patients (43%). Patients dying of infection were more likely than those who died of other causes to have received ≥2 lines of treatment (194/258 [75%] versus 231/342 [68%], P = 0.04) and to have died in the winter months (149/258 [58%] versus 166/342 [49%], P = 0.03), respectively. In patients with mutation data, the factors significantly associated with death from infection versus all other deaths were 11q deletion (47/162 [29%] versus 40/209 [19%], P = 0.03) and mutations of the BRAF, FBXW7, NRAS and XPO1 genes. Death was caused by an infection in 46/67 assessable patients (69%) who had a mutation of one or more of these four genes versus only 129/333 patients (39%) without any of these mutations (odds ratio: 3.46 [95% CI 1.98–6.07] P < 0.0001). Careful management of infection risk, including prophylaxis against infection, may be important in patients who carry these mutations.

Despite advances in chronic lymphocytic leukaemia (CLL) treatment, globally chemotherapy remains a central treatment modality, with chemotherapy trials representing an invaluable resource to explore disease-related/genetic features contributing to long-term outcomes. In 499 LRF CLL4 cases, a trial with >12 years follow-up, we employed targeted resequencing of 22 genes, identifying 623 mutations. After background mutation rate correction, 11/22 genes were recurrently mutated at frequencies between 3.6% (NFKBIE) and 24% (SF3B1). Mutations beyond Sanger resolution (<12% VAF) were observed in all genes, with KRAS mutations principally composed of these low VAF variants. Firstly, employing orthogonal approaches to confirm <12% VAF TP53 mutations, we assessed the clinical impact of TP53 clonal architecture. Whilst ≥ 12% VAF TP53mut cases were associated with reduced PFS and OS, we could not demonstrate a difference between <12% VAF TP53 mutations and either wild type or ≥12% VAF TP53mut cases. Secondly, we identified biallelic BIRC3 lesions (mutation and deletion) as an independent marker of inferior PFS and OS. Finally, we observed that mutated MAPK-ERK genes were independent markers of poor OS in multivariate survival analysis. In conclusion, our study supports using targeted resequencing of expanded gene panels to elucidate the prognostic impact of gene mutations.

This is an historical account of the randomised trials in chronic lymphocytic leukaemia in the UK between the years 1978 to 2004, describing their gestation, the treatments used and the main lessons learnt. Those lessons include: (1) how best to use chlorambucil, which was the first effective treatment for CLL; (2) the significant difference in survival between the sexes; and (3) the value of prognostic markers, both morphological and molecular, which continue to be relevant to current practice.

BACKGROUND: T-cell prolymphocytic leukemia (T-PLL) is a rare, aggressive, post thymic lymphoid malignancy, with an incidence of approximately 0.1/100,000 people. T-PLL accounts for ~2% of all mature lymphocytic leukaemias in adults >30 years. Median overall survival (OS) ~20 months and long term remissions are infrequent. Intravenous alemtuzumab, a monoclonal antibody directed against CD52 remains the most effective treatment in T-PLL. At the Royal Marsden Hospital (RMH) we have been using alemtuzumab for T-PLL since the early 1990s. We describe our experience over the last 3 decades. METHODS: We included 174 T-PLL patients that were diagnosed or treated at RMH between 1989-2019. Immunophenotyping data was available through our hematological malignancy diagnostic service (HMDS) from 1998 onwards. Kaplan-Meier analysis was used for OS and disease free interval (DFI) RESULTS: There were 174 patients in total. Mean age at diagnosis was 61 years old (range 32-88) and M: F ratio was ~2:1 (113:61). 90 patients had reliable information on complete blood count (CBC) at diagnosis with median white blood cell count of 74 x 109/L (range 10-918), median hemoglobin 126 g/L (range 59-175) and median platelet count 116 x 109/L (range 7-513). Sufficient immunophenotyping data was available for analysis in 135/174 patients. The results showed predictably high expression of CD2, CD3, CD5, CD7, CD52 and TCRαβ. CD25 was positive in 67/135 (50%) of cases which is higher than the 18-35% seen in the current literature. CD4+/CD8- cases comprised 83/135 (61%) with CD4-/CD8+ 19/135 (14%), CD4+/CD8+ 32/135 (23%) and CD4-/CD8- 2/135 (2%). These results are summarized in table 1. Karyotyping/FISH (fluorescent in-situ hybridization) records showed a clonal result in 84 patients and of these 65/84 (77%) had an aberration of chromosome 14. These comprised 48/65 with inv(14), 6/65 t(14;14), 2/65 t(X;14), 1/65 TCL1 gene rearrangement by FISH and 8/65 with TRA/TRD involvement by FISH. Other frequent abnormalities seen were i(8)(q10) in 31/84 (39%) and complex karyotypic abnormality in 40/84 (48%). Lower frequency abnormalities seen were monosomy 11 in 8/84 (9%), monosomy 12 in 8/84 (9%), trisomy 8 in 6/84 (7%), 17p loss in 5/84 (6%) and mononsomy 13 in 4/84 (5%). Alemtuzumab was used in 116 patients, 69/116 (59%) receiving it as frontline treatment and 47/116 (41%) as salvage therapy. In 50/116 (43%) alemtuzumab was used as single agent, the remaining 66/116 (57%) receiving combination therapy, mostly pentostatin. Mean time from diagnosis to receiving alemtuzumab was 6.8 months (range 0-53 months). Overall response rate (ORR) to alemtuzumab was 94/116 (81%) with complete remission (CR) 69/116 (59%), partial remission (PR) 25/116 (22%) and no response (NR) 20/116 (17%). Alemtuzumab produced better response rates when used as frontline therapy. Table 2 summarizes these results and OS and DFI are shown in figures B and C. Allogeneic stem cell transplant (allo-SCT) was performed in 34 patients. Median OS post allo-SCT was 22 months and median DFI 31 months. Relapse rate post allo-SCT was 47%, non-relapse mortality 38% and transplant related mortality 29%. Figures D and E show OS and DFI post allo-SCT. Although relapse rates are high post allo-SCT there is a small cohort of patients who are achieving long term remission. We analysed OS by decade of diagnosis covering 3 decades 1990-1999, 2000-2009 and 2010-2019. The median OS for the whole cohort was 20.6 months with median OS of 21 months, 23 months and 19 months for each decade respectively. Results are shown in figure A. There was no statistically significant difference between the curves by log-rank analysis. DISCUSSION: Immunophenotyping results were similar to previous published data on T-PLL except for an increase in CD25 expression at 50%. Our data shows that outcomes in T-PLL have remained unchanged since the first decade of alemtuzumab usage, with no improvement in OS in the last 20 years. Despite improvements in diagnostic techniques and supportive care median OS is static at approximately 20 months. These results highlight the need for novel therapies in T-PLL. Given the rarity of T-PLL, international, multi-center, randomised trials are needed to improve outcomes. Disclosures Cross: Royal Marsden Cancer Charity: Other: MD Residency, Research Funding. Iyengar:Abbvie: Honoraria; Janssen: Honoraria. Dearden:Janssen: Honoraria; Genentech: Honoraria; Abbvie: Honoraria; Sanofi: Honoraria.

Chronic lymphocytic leukemia patients with mutated immunoglobulin heavy-chain genes (IGHV-M), particularly those lacking poor-risk genomic lesions, often respond well to chemoimmunotherapy (CIT). DNA methylation profiling can subdivide early-stage patients into naive B-cell-like CLL (n-CLL), memory B-cell-like CLL (m-CLL), and intermediate CLL (i-CLL), with differing times to first treatment and overall survival. However, whether DNA methylation can identify patients destined to respond favorably to CIT has not been ascertained. We classified treatment-naive patients (n = 605) from 3 UK chemo and CIT clinical trials into the 3 epigenetic subgroups, using pyrosequencing and microarray analysis, and performed expansive survival analysis. The n-CLL, i-CLL, and m-CLL signatures were found in 80% (n = 245/305), 17% (53/305), and 2% (7/305) of IGHV-unmutated (IGHV-U) cases, respectively, and in 9%, (19/216), 50% (108/216), and 41% (89/216) of IGHV-M cases, respectively. Multivariate Cox proportional analysis identified m-CLL as an independent prognostic factor for overall survival (hazard ratio [HR], 0.46; 95% confidence interval [CI], 0.24-0.87; P = .018) in CLL4, and for progression-free survival (HR, 0.25; 95% CI, 0.10-0.57; P = .002) in ARCTIC and ADMIRE patients. The analysis of epigenetic subgroups in patients entered into 3 first-line UK CLL trials identifies m-CLL as an independent marker of prolonged survival and may aid in the identification of patients destined to demonstrate prolonged survival after CIT.

This chapter deals with the basic demographics and the presenting features of CLL and how to assess patients once a diagnosis has been made. CLL is predominantly a disease of the elderly with a preponderance of male patients. New evidence suggests that there are variations in gender incidence according to the clinical status of patients, with a higher male:female ratio in the groups with worse prognosis. Full blood counts and a physical examination are the basis of the existing staging systems of Rai and Binet. Establishing the patient’s clinical stage sets the scene for the frequency of follow-up, the possible need for therapy and the need for cytogenetic and molecular investigations. Examination of blood films is still important, to identify the presence of prolymphocytes and to consider alternative diagnostic possibilities. In addition, biochemical tests such as beta-2 microglobulin and lactate dehydrogenase are a valuable part of the prognostic evaluation. Patients may need support to deal with the psychological and quality of life issues arising from their disease.

Even in the era of the targeted therapies, there remains clinical value in exploring the impact of disease characteristics in chemo-immunotherapy (CIT) trials, namely to identify features that contribute most to long-term outcomes, thereby pinpointing patients destined to benefit from these therapies. One such feature is the CLL DNA methylome, that recapitulates normal B cell maturation, with IGHV mutated (M-CLL) and unmutated CLL (U-CLL) retaining an imprint of the DNA methylation signature of memory (m-CLL) and naive B cells (n-CLL), respectively, with a third intermediate epigenetic subgroup (i-CLL) with borderline mutation status. The pyrosequencing analysis of 5 CpG sites can divide CLL into these three subgroups (Queiros 2015, Leukemia 29:598-605), each with different clinico-biological features.

Patients with a Memory-like DNA Methylation Signature exhibit long-term survival after first-line immuno-chemotherapy : Data from the UK CLL4, ARCTIC and ADMIRE trials

Despite the excitement of targeted therapies such asibrutinib and idelalisib, the longer-term follow-up offered by early immuno/-chemotherapy trials presents opportunities to explore the disease features that contribute most to long-term outcomes.

SummaryHistorically, an increase in the percentage and number of circulating prolymphocytes in chronic lymphocytic leukaemia (CLL) has been associated with strong expression of surface immunoglobulin, trisomy 12 and a poor outcome. This study re‐examines the biological and clinical significance of increased peripheral blood prolymphocytes in 508 patients at entry into the randomized UK Leukaemia Research Fund CLL4 trial. It also investigates the associations between increased prolymphocytes and a comprehensive array of biomarkers. 270 patients (53%) had <5% prolymphocytes, 167 (33%) had 5–9%, 60 (12%) had 10–14% and 11 (2%) had ≥15% prolymphocytes. We show that a higher proportion of prolymphocytes (≥10%) was independently associated with NOTCH1 mutations (P = 0·006), absence of 13q deletion (P = 0·001), high CD38 expression (P = 0·02) and unmutated IGHV genes (P = 0·01). Deaths due to Richter syndrome were significantly more common amongst patients who had ≥10% vs <10% prolymphocytes (13% vs 2%) respectively (P < 0·0001). ≥10% prolymphocytes was also associated with a shorter progression‐free survival (Hazard ratio [HR] 1·50 [95% confidence interval [CI]: 1·16–1·93], P = 0·002) and overall survival (HR 1·99 [95% CI: 1·53–2·59], P < 0·0001). Our data support the routine examination of blood films in CLL and suggest that a finding of an increased proportion of prolymphocytes may be a trigger for further evaluation of clinical and laboratory features of progressive disease.

In chronic lymphocytic leukemia (CLL), 'coding' NOTCH1 mutations were initially detected in exon 34, where they result in truncation of the C-PEST regulatory protein sequence, with consequent impaired degradation of the Notch1 intracellular domain (NCID), constitutive activation of Notch signalling and increased cell survival and resistance to apoptosis 1-3 .Mutations occur in 6-10% of cases at diagnosis, with increasing prevalence in advanced disease stages, treatment-refractory disease, and after transformation to Richter syndrome 4,5 .In diagnostic and clinical trial cohorts, patients with NOTCH1 mutations exhibited reduced survival 5,6 .In 2015, Puente and colleagues identified recurrent 'non-coding' mutations clustered to the 3' UTR of NOTCH1 in 2% (11/506) previously untreated patients with CLL or monoclonal B-cell lymphocytosis 7 .The presence of these 3'UTR mutations cause a novel splicing event, preferentially between a cryptic donor site located in the last exon and a newly created acceptor site in the 3'UTR of exon 34, resulting in the removal of the PEST sequence and constitutive activation of downstream signalling 7 .Patients with noncoding NOTCH1 mutations had similar outcomes to those with coding mutations, with shorter time to first treatment and shorter overall survival than wild type cases 7,8 .Given the highly variable natural history of CLL and the often-serendipitous date of initial diagnosis, we aimed to establish the clinical significance of non-coding NOTCH1 mutations in DNA samples available from 489 patients at enrolment to the United Kingdom Leukemia Research Fund Chronic Lymphocytic Leukemia 4 (UK LRF CLL4) chemotherapy trial 9 .NOTCH1 3' UTR mutations were identified by High Resolution Melt (HRM) analysis in whole genome amplified DNA (F: TGCTCGTTCAACTTCCCTTC; R: CAAGCAAGTTCTGAGAGCCA) and confirmed by Sanger sequencing of genomic DNA (F: CCTAACAGGCAGGTGATGCT; R: ATCTGGCCCCAGGTAGAAAC) The results were combined with the data pertaining to coding NOTCH1 mutations in the same patient cohort from our previous publication 5 .53 patients with wild-type HRM traces were sequenced, and no additional non-coding mutations were identified.It is was not possible to differentiate between clonal and sub-clonal NOTCH1 mutations using our HRM/Sanger approach.We defined associations between the presence of NOTCH1 coding and non-coding mutation and a comprehensive panel of clinical and biological features reported in previous CLL4 papers [10][11][12][13] , by univariate logistic regression.Kaplan-Meier, log-rank test and Cox regression analysis were used to assess the impact of NOTCH1 status on survival using Stata, where overall (OS) and progression-free (PFS) survival were defined as time from randomization to death from any cause and to relapse needing treatment, progression or death from any cause at last follow-up, respectively.In addition to exon 34 coding mutations observed in 47/489 (9.6%) CLL4 patients, we detected an additional 11/489 (2.2%) patients harbouring the non-coding mutations 139390152 A>G (n=7) and 139390145 A>G (n=4) (Figure 1A), both previously reported to result in aberrant NOTCH1 splicing 7 .Importantly, the non-coding variants were mutually