This case report presents a recent case of scuticociliatosis in a whitetip reef shark (Triaenodon obesus), housed at a zoo (Haus des Meeres Aqua Terra Zoo, Vienna, Austria). Clinical signs such as uncoordinated swimming and body tilt were observed prior to death. Postmortem examination and magnetic resonance imaging (MRI) revealed significant brain lesions consistent with granulomatous or necrotising encephalitis. Histopathology and molecular diagnostics confirmed the presence of the scuticociliate Miamiensis avidus and/or Philasterides dicentrarchi in the brain, with extensive tissue invasion. This case underscores the pathogenicity of scuticociliates in elasmobranchs, highlighting the need for effective management practices in aquaria to prevent or mitigate such infections. In this study, we present the first documented infection with scuticociliates in the whitetip reef shark.

In the River Traun in Austria, diseased European chub Squalius cephalus were observed for several years. In 2019, an investigation of the condition revealed the presence of several myxozoan species in different tissues, without evidence of other pathogens. The most prevalent and abundant myxozoan parasite in the different organs was Myxobolus ellipsoides ex S. cephalus, a parasite formerly only reported to infect the fin of European chub. To further investigate tissue tropism and molecular data of this parasite, samples from 11 different organs of 13 European chub were collected 1 yr later and examined with various methods. Myxospore morphology was assessed by microscopy and compared to the literature. A specific PCR protocol targeting the 18S rRNA gene of M. ellipsoides ex S. cephalus and subsequent sequence analyses detected 11 different 18S variants clustering into 2 groups. To differentiate M. ellipsoides ex S. cephalus unambiguously from other myxozoan parasites in the tissues, histological methods and in situ hybridization with a species-specific probe targeting the 18S rRNA of the parasite were applied. DNA of M. ellipsoides ex S. cephalus could be detected by PCR in each of the examined fish in at least 2 of the sampled organs, but not in any blood sample. In 2 fish, M. ellipsoides ex S. cephalus myxospores were detected in plasmodia in the kidney. Our findings present new data regarding tissue tropism and molecular diversity of M. ellipsoides ex S. cephalus in European chub and provide a basis for further studies investigating possible health impacts by this parasite.

Newly stocked Danube sturgeons Acipenser gueldenstaedtii developed cutaneous lesions and nearly 100% mortality over the course of 2 mo after introduction into an Austrian fish farm. Necropsy revealed cutaneous plaques and hemorrhages, and histological findings in skin, gills, spleen and kidney tissues showed cell-nucleus alterations consistent with infection by a herpesvirus. The presence of a herpesvirus was demonstrated by the visualization of numerous typical viral particles in different tissues by electron microscopy. A newly developed conventional PCR protocol, targeting a fragment of the viral DNA polymerase gene, further confirmed the presence of a virus related to the species Ictavirus acipenseridallo2 (formerly Acipenserid herpesvirus-2; AciHV-2) in the diseased fish. Amplification products were sequenced and showed 100% identity to the Siberian sturgeon herpesvirus (SbSHV) strain. This is the first report of herpesvirus detection in sturgeon in Austria and of SbSHV, a strain of AciHV-2, in Danube sturgeons.

Discocotyle sagittata (Leuckart, 1842) (Monogenea: Discocotylidae) is redescribed, based on specimens collected from the type host, Salmo trutta Linnaeus, from the type locality, Freiburg, Germany, supplemented with specimens from S. trutta and rainbow trout, Oncorhynchus mykiss (Walbaum) reared in an Austrian aquarium. The diagnosis of the genus Discocotyle Diesing, 1850 is emended. Discocotyle cirayn. sp. is described, based on immature, preadult and adult specimens from the salmonid, Parahucho perryi (Brevoort) at Eniwa, Hokkaido, Japan. Adult specimens of the new species were about twice as large as those of D. sagittata from S. trutta. When the type specimens of D. cirayn. sp. were examined together with museum specimens from P. perryi at Tsurui, Hokkaido, the body and clamp sizes were positively correlated to the host size. Their measurements from a smaller P. perryi at Tsurui overlapped with those of D. sagittata, showing that these size differences were not suitable differentiating keys. Discocotyle cirayn. sp. can be separated from D. sagittata by the morphologies of the female genital system (relatively anteriorly positioned ovary, short joint vaginal duct and much more strongly winding uterus). The genetic distances of COI mtDNA sequence between D. cirayn. sp. and D. sagittata were 18.0-18.6%. These remarkable genetic divergences also supported the distinct taxonomic status of D. cirayn. sp.

The thick-shelled river mussel Unio crassus Philipsson, 1788 is a species native to many European habitats, with declining populations. The impact of parasite communities on health status of this species is poorly understood. In this study, parasites of 30 U. crassus specimens from the Our and Sauer Rivers in Luxembourg were identified morphologically and, in some cases, using molecular genetic methods. The findings were correlated to selected parameters (total length, visceral weight, shell lesions, gonadal stage). The 2 populations did not differ in shell length, visceral weight, number of males and females, gonadal scoring, shell lesions, and the occurrence of glochidia. The prevalence and infestation intensities of detected Trichodina sp., Conchophthirus sp., and freshwater mite larvae did not differ between the 2 populations, whereas the prevalence and infestation intensities of mite eggs, nymphs, and adults were significantly higher in the Sauer River. Rhipidocotyle campanula and European bitterling Rhodeus amarus larvae were only present in the Sauer. Histopathology revealed the destruction of the gonads by R. campanula and tissue damage by the mites. The only significant correlation of the selected parameters was a positive correlation between R. amarus occurrence and total length as well as a negative correlation between R. amarus occurrence and gonadal stage. In the Sauer River, 2 mussels were found to be hermaphrodites.

A sample of 30 thick-shelled river mussels Unio crassus Philipsson (Unionida: Unionidae) was collected from the River Sauer in Luxembourg to acquire data on parasitic infestations of the mussels. Among other parasites, different development stages of freshwater mites were collected from the gills and the mantle of the mussels and were documented with bright-field, stereo, and confocal laser scanning microscopy and microscopic X-ray computed tomography. The retrieved data allowed a morphological description of larvae and female adults of the mites and assigning them to the genus Unionicola Haldeman (Trombidiformes: Unionicolidae) and the subgenus Pentatax Thor. Additionally, adult stages and larvae were barcoded by sequencing a section of the mitochondrial COI and 18S rRNA genes. This resulted in 4 new, similar Unionicola lineages from the adult stages, which differ in at least 14.7% (uncorrected p distance) from those already published. Barcoding of larval DNA was not successful. The comparison with known European species of the genus Unionicola and analysis of the barcoding results allowed the proposal of a new species of the genus Unionicola. The species was named Unionicola sauerensis sp. nov. after the River Sauer in Luxembourg, where the infested mussels were collected.

The Museum Niederösterreich, Haus für Natur (St. Pölten, Lower Austria), features a large fish exhibition. In one of the tanks, the main attraction was a large huchen (Hucho hucho). The tank was holding 22,000 L of recirculated water with a temperature between 10°C and 14°C. Every 2 weeks, 10% of the water was replaced. In addition to several cyprinid fish species, rainbow trout (Oncorhynchus mykiss) were introduced occasionally to the tank to serve as food fish for the huchen. These trout were acquired from a distributor in Germany. In March 2020, a number of brown trout (Salmo trutta) from an Austrian breeder were also added to the tank. During the following months, a portion of the rainbow trout died with no further investigations performed. In December 2020, three rainbow trout were observed to be lethargic and subsequently died a few days later. One of them was submitted to the Clinical Division of Fish Medicine of the University of Veterinary Medicine, Vienna, within 24 hr. During the following weeks, a new setup of the tank was planned and the remaining trout were thus also submitted for examination. In total, two rainbow trout (29 cm and 32 cm, 213 g and 272 g, respectively) and four brown trout (21– 28 cm, 107– 185 g) were collected. Fish that arrived alive at the clinic (three out of four brown trout) were killed (buffered MS 222, 1 g/L; SigmaAldrich). Necropsy of these three brown trout showed no pathological changes. In contrast, the two deceased rainbow trout and the deceased brown trout showed extremely pale gills and internal organs, which could not be attributed to decaying processes and, instead, were indicative of severe generalized anaemia (Figure 1). Attached to their gill filaments, parasitic worms were observed with the naked eye. The gill arches were removed, placed in Petri dishes with distilled water and examined with a stereo microscope (Olympus SZX 10, Olympus Austria). Fifty to >100 worms were observed on each of the four gill arches. Most of them were attached to the peripheral region of the filaments, whereas fewer parasites were observed in close proximity to the gill skeleton. The first gill arches carried the highest parasitic burden (70 to >100 specimens). The small number of examined fish did not allow for statistical analysis of these findings. For further morphological identification, the worms were examined with stereoand brightfield microscopy (Olympus BX 53, Olympus Austria). Two buccal suckers and four pairs of characteristic clamps at the posterior end allowed a preliminary identification as the monogenean Discocotyle sagittata (Leuckart 1842) based on the description provided by Pugachev et al., (2010). The size of the parasites varied from 2 to 10 mm. The developmental stages were differentiated according to RubioGodoy and Tinsley (2002) based on the number of clamp pairs and sexual maturity. In the 170 investigated parasite specimens, only individuals with four clamp pairs were found – of which 25 (14.7%) were producing one (22/25) or two (3/25) eggs (Figure 2). For molecular specification, the DNA of six individual specimens was extracted using a DNeasy Blood and Tissue kit (Qiagen) and analysed using nested PCR targeting of the 650bp section of the 18S rRNA gene (18S) of metazoan (Metazoa18S_F: GGATAACTGTGGTAATTCTAGAGC, Metazoa18S_R: CCTCACTAAATCATTCAATCGGTAG; Metazoa18S_ intF: 5′GTAATTCCAGCTCCAATAGCGT3′, Metazoa18S_intR: 5′CCGTGTTGAGTCAAATTAAGCC3′; Lewisch et al., 2021). The

Acanthocephalan parasites were collected from the intestinal tracts of 137 predominantly wild fish (1 barbel Barbus barbus, 3 European chub Squalius cephalus, 13 rainbow trout Oncorhynchus mykiss and 120 brown trout Salmo trutta) from 12 localities. The condition factor, intensity of acanthocephalan infection and pathological lesions, if applicable, were documented. Routine bacteriology and virology were performed, and the brown trout were additionally tested for the presence of the myxozoan parasite Tetracapsolioides bryosalmonae by PCR. In total, 113 acanthocephalans were barcoded by sequencing a section of the mitochondrial cytochrome oxidase subunit I (COI) gene. Barcoding of the acanthocephalan tissues resulted in 77 sequences, of which 56 were assigned to Echinorhynchus truttae (3 genotypes), 11 to Pomphorhynchus tereticollis (9 genotypes), 9 to Acanthocephalus sp. (5 genotypes) and 1 to Neoechinorhynchida. Most of these genotypes were detected for the first time. Statistically, the acanthocephalan infection did not have an impact on the condition factor of the brown trout. Infection with P. tereticollis caused more severe pathological changes in the digestive tract than E. truttae. The present study provides new data regarding the distribution of acanthocephalan species in Austria and their impact on individual fish. In addition, new barcoding data from acanthocephalan parasites are presented, and the occurrence of P. tereticollis in European chub in Austria and in brown and rainbow trout in general was confirmed for the first time.

A severe episode of high and abnormal mortality was observed in the population of Cyprinus carpio of Lake Caldaro (South Tyrol, Italy) in summer 2016. The diagnostic investigation carried out led to the identification of Koi Herpesvirus (KHV) as the etiologic agent. Following this disease outbreak and its socio-economic consequences, the local authorities, in agreement with the local Fishing Association, decided to implement a surveillance program for the achievement of KHV-free health status (Category I) in the Province, in accordance to the Implementing Decision (EU) 2015/1554. The selected area was a defined geographical compartment (the Monticolo lakes compartment, South Tyrol, Italy), which is located near Lake Caldaro, where the Koi Herpesvirus disease (KHVD) outbreak had occurred. This area is of particular interest because it supplies other water bodies with juvenile C. carpio individuals; with the achievement of a KHV-free health status, South Tyrol could possibly become independent in the breeding of this fish species. Suitable samples were collected and processed during a two-year period in order to detect the presence/absence of KHV. The same samples were tested for other viruses that can affect carp, namely spring viraemia of carp (SVCV) and carp edema virus (CEV). According to the results, the authors conclude that the Monticolo lakes area should be classified as KHV-free, as no sample has tested positively for the presence of this specific virus (KHV).

AbstractHole‐in‐the‐head (HITH) disease‐affected fish develop characteristic lesions in the skin above sensory pores of the head and the trunk. This study investigated whether an unfavourable Ca/P ratio in the diet could provoke lesions consistent with HITH disease in discus fish Symphysodon (Heckel, 1840) as a comparable condition to secondary hyperparathyroidism of tetrapod species. Two groups of five fish were fed a plain beef heart diet (Ca/P of 0.03), whereas two other groups were kept on commercial discus feed (Ca/P of 2.73). Each feeding group was submitted to two different water hardness regimes (35.66–71.39 mg/L CaCO3 and 124.94–196.33 mg/L CaCO3, respectively). All fish were observed for the development of the characteristic lesions for 16 weeks. At the end of the study, histological, bacteriological and parasitological examinations were conducted and plasma Ca, P and Mg values were determined. Diplomonad flagellates were detected in two fish. Isolated bacteria of all groups mostly belonged to Aeromonadales and Pseudomonadales. No significant difference of plasma mineral values between the groups was observed. Compared to the results of other authors, Ca stayed mainly in the range and P exceeded the reference values. Histological examinations did not indicate HITH disease, and no fish developed signs of the disease during the study.Clinical trial registration number GZ 68.205/0135‐WF/V/36/2014.

Carp edema virus disease (CEVD), also known as koi sleepy disease (KSD), is an emerging viral disease caused by the carp edema virus (CEV). It is characterized by lethargic behavior, gill necrosis, and generalized edema, leading to significant morbidity and mortality in common carp and koi Cyprinus carpio. Accurate diagnosis of CEVD relies on amplification of a P4a protein-encoding DNA segment from the CEV genome. A phylogenetic analysis of amplified fragments revealed 3 distinct CEV genogroups: I, IIa, and IIb. We explored the phylogenetic relationship between Austrian CEV isolates with existing CEV genogroups. The phylogenetic analysis (n = 18) established the presence of the 3 extant CEV genogroups as well as 2 new CEV genogroups (IIIa and IIIb) classified to identify the Austrian isolates that were distinct from the existing CEV genogroups. It is evident that CEV infection cases are growing in number each year, which may be due to development of sensitive diagnostic assays, while information regarding the virus is scarce. National and international efforts are required to study the epidemiology of the CEV in major carp-producing countries.

The first evidence of proliferative kidney disease (PKD) in an Austrian river (the River Kamp) was documented in 2016, and no information on the PKD infection status of trout in other rivers was available. Since then, brown trout (Salmo trutta fario) and rainbow trout (Oncorhynchus mykiss) have been collected from rivers in Upper and Lower Austria for different diagnostic purposes. In this study, we summarize the recent findings of a first survey concerning the distribution of Tetracapsuloides bryosalmonae, the causative agent of proliferative kidney disease (PKD), from these samples. Between September 2015 and October 2017, a total of 280 brown trout and 39 rainbow trout were collected from 21 rivers in the provinces of Upper and Lower Austria. T. bryosalmonae was detected by PCR of kidney tissue in 17 of 21 sampled rivers and in 138 of 280 brown trout as well as in 11 of 39 rainbow trout. Pathological signs of PKD (e.g., hypertrophy of the kidney) were observed in 33 analysed brown trout and six rainbow trout samples. No correlations between fish infected by T. bryosalmonae and the parameters size and age class, condition factor, geological origin of the streams and distribution within the river course were found, while positively tested fish are significantly increased at sampling sites exceeding water temperatures of 15°C for median periods of 115 days. The prevalence within the affected streams or stream sections is highly variable, and in single rivers, infection rates of up to 90% are confirmed.

Discus ( Symphysodon discus) maintained in aquaria are held in a wide range of water parameters and subjected to many different feeding regimes. In a pilot study, four groups of discus (mean length 12.1 cm, mean weight 57.3 g) were submitted to a radiographic examination to assess the skeletal structure of the vertebral column under defined environmental conditions. Water temperature was 30°C for all groups. Two groups were held at <28.6 mg/L calcium (Ca) and two at 50.0-78.6 mg/L Ca within the ambient water. One of each water quality group was fed a commercial discus diet while the other two groups were kept on a plain beef-heart diet, creating a total of four separate groups. In the case of the beef heart group, dietary Ca content (g/kg) was 0.06 and phosphorous (P) content 2.06, leading to a Ca : P ratio of 0.03, whereas in the commercial diet group a Ca content of 20.1 g/kg and P of 7.36 g/kg resulted in a Ca : P ratio of 2.7. Magnesium (Mg) contents of the beef-heart diet were 0.21 and of the commercial diet 1.69 g/kg. Six fish were submitted to radiography at the beginning of the experiment as a control. After 16 wk of the above diets and environmental conditions, radiographs were taken from all fish (six per group) and evaluated by three independent persons using a scoring system. Alterations were found in all groups. The results of this pilot study give reason to scrutinize rearing and keeping conditions of this fish species.

To date, sleeping disease (SD) caused by salmonid alphavirus 2 (SAV 2) has been reported in freshwater rainbow trout Oncorhynchus mykiss and Atlantic salmon Salmo salar. This study describes for the first time the occurrence of SD in farm-reared Arctic char Salvelinus alpinus and the occurrence of SAV in Austria. Clinical symptoms were indicative of the disease, and the diagnosis was confirmed by histopathology, infectivity in first passages of CHSE-214 cells and PCR. The phylogenetic analysis of the amplified SAV-nonstructural protein-3 (nsP3) fragment revealed the affiliation to the SAV 2 genotype.

The aim this study was to assess the health status of fish, especially brown trout (Salmo trutta), in waters where severe decrease of brown trout catches had been observed. Over the course of one year, 116 brown trout, 22 rainbow trout (Oncorhynchus mykiss), eleven European chubs (Squalius cephalus) and several specimens of other fish were sampled. Samples were taken each month and originated from 22 different sites along 15 rivers. All fish underwent necropsy, including parasitological, bacterial, and viral examination. The most relevant finding was a wide distribution of Tetracapsuloides bryosalmonae, the causative agent of proliferative kidney disease (PKD) (12/22 sites) with high prevalence in the affected waters. One rainbow trout was found to be infected with viral hemorrhagic septicemia virus (VHS-V) and several rainbow trout and brown trout were positive, for infectious pancreatic necrosis-virus (IPN-V). Three brown trout were positive for Aeromonas salmonicida achromogenes; the bacterium was cultivated from the head kidney. Infestation with skin and gill parasites was demonstrated in 6.9 % of brown trout and 4.5 % of rainbow trout. There was no obvious tissue damage caused by these ectoparasites. Infestation with acanthocephales led to gastrointestinal lesions and even gut perforation in brown trout, European chub, brook trout (Salvelinus fontinalis) and common barbel (Barbus barbus). In several brown trout, granulomas in the intestinal tract were associated with nematode infection.

Francisellosis, an emerging disease in many fish species, can cause high mortality in affected populations. Here we investigated the susceptibility of common carp Cyprinus carpio and sunfish Lepomis gibbosus to Francisella noatunensis subsp. orientalis (Fno), and possible transmission of the bacteria between the 2 fish species. In a challenge experiment, 3 groups of each species were injected intraperitoneally (IP) with 3 different doses of an Fno strain no. 9449 of the Norwegian Veterinary Institute, recovered from naturally infected ornamental Malawi cichlids. Infected carp were cohabitated with sunfish and vice versa. Control groups were injected with 0.9M phosphate-buffered saline and cohabitated accordingly. Fish were sampled at different time points. Mortality of challenged sunfish was observed during the first 96 h and reached 56.1%. In the control sunfish, 4 of 16 fish (25%) died within 48 h. In carp, no mortalities or clinical signs were observed during the experiment. General clinical and patho-anatomical disease signs of affected sunfish were observed. We detected granulomas in 2 cohabitated sunfish and 1 challenged carp, but could not re-isolate Fno from these fish. Fno was successfully cultured from 6 sunfish and 3 carp specimens until 35 d post injection. PCR of spleen and kidney with 16S rDNA Francisella-like bacterium primers 180f and 485r yielded amplicons in 68.3% of challenged sunfish and only 12.2% of challenged carp. We demonstrated that sunfish were susceptible to Fno infection while the carp were not. Horizontal transmission of the agent between the 2 fish species could not be demonstrated.

Hole-in-the-head disease is common in marine and freshwater fish. The fish develop supra- and infraorbital lesions in the skin above the lateral line channels of the head and the body. Depending on the severity of the lesions, the fish can show apathy and refuse food. A secondary bacterial infection may lead to death. This review summarizes all the causes of the condition that have been mentioned in the literature. There is still no agreement on the aetiology of the disease. Possible causes include infection with pathogenic agents, activated carbon, water composition, malnutrition, lack of ultraviolet light, stray current, stress and the uptake of copper. The published options for treatment are discussed.

The genus Dermocystidium comprises fungal pathogens of the order Dermocystida in the class Ichthyosporea (http://www.ncbi.nlm.nih.gov/taxonomy). Several different Dermocystidium species have been described, infecting a variety of fish hosts and producing gill infections, skin lesions and visceral disease all over the world (Wildgoose 1995; Pekkarinen & Lotman 2003; Pekkarinen et al. 2003; Feist et al. 2004; Zhang & Wang 2005). To our knowledge, there are two reports on Dermocystidium infections in cardinal tetra, Paracheirodon axelrodi and neon tetra, Paracheirodon innesi (Reichenbach-Klinke 1982; Lewisch 2010). However, these reports did neither include histological and ultrastructural examinations nor molecular genetic investigations to confirm the diagnosis and identify the aetiologic species. In January 2013, increased mortalities of cardinal tetra, P. axelrodi of a 350-L aquarium were reported, occurring after purchase of additional fish. During the clinical examination, most of the fish were swimming in normal active condition, but some were lethargic or displayed a transparent mass on the skin of the head or body. The masses were up to 5 mm in diameter and contained a central, white tubular structure. Similar masses were located on the fins of some fish, but were considerably smaller in these locations. A parasitic infestation of the skin of these fish was excluded via microscopic examination, and normal results were obtained after analysis of the water values and inspection of the pump and filter system. Six cardinal tetra, P. axelrodi and two firehead tetra, Hemigrammus bleheri were submitted for pathological examination in formalin and for molecular genetic examination in ethanol. Only two cardinal tetra displayed skin lesions. Before embedding, one tetra was post-fixed in Davidson’s fixative and sections of glycolmethacrylate/methylmethacrylate-embedded samples were routinely processed for histological examination and stained with haematoxylin and eosin (HE), Giemsa, silver impregnation and periodic acid Schiff (PAS) reaction according to standard protocols. Samples of the mass were also routinely processed for transmission and scanning electron microscopy on a transmission electron microscope (Zeiss EM 10) or on a digital scanning electron microscope (Zeiss DSM 950), respectively. The macroscopic examination of the cardinal tetra revealed a focally extensive, bulging, hemispherical, transparent oedema (4 mm in diameter) of the ventral skin on the head. Central, within Correspondence M C Langenmayer, Institute of Veterinary Pathology at the Centre for Clinical Veterinary Medicine, LMU Munich, Veterin€ arstrasse 13, 80539 Munich, Germany (e-mail: langenmayer@patho.vetmed.uni-muenchen.de) Langenmayer and Lewisch contributed equally to this work.

A new species of the genus Thelohanellus Kudo, 1933 (Myxosporea, Bivalvulida) was isolated from the fins of goldfish Carassius auratus auratus (Linnaeus 1758). The fish had been imported from China by an Austrian retailer. Nodules from the margins of the fins contained pyriform myxospores with a singular polar capsule. In valvular view, the spores measured 12.2 µm in length and 6.4 µm in width. In sutural view, the thickness was 2.9 µm. The polar capsule measured 4.2 × 3.1 µm and contained a polar filament with 8 to 9 coils. Histological sections showed plasmodia of 0.2 to 4.0 mm diameter with the earlier developmental stages of the parasite in the periphery and the mature spores closer to the center. In the transmission electron microscope examination, the different developmental stages could be observed. Morphological data, host specificity, tissue tropism, and molecular analysis of the small subunit rDNA identify this parasite as a new species of Thelohanellus, which we have named Thelohanellus hoffmanni sp. nov.