In this study, the prevalence and genome diversity of apple stem pitting virus (ASPV) in commercial pear orchards in South Africa were investigated. Leaves were collected from trees in two geographically distinct regions, representing six different pear cultivars covering 12 orchards. Total RNA was extracted and assayed for ASPV using RT-PCR. A subset of 18 samples was subjected to high-throughput sequencing (HTS) for a more detailed analysis. Bioinformatic analyses of the HTS data, led to the identification and sequencing of a divergent ASPV variant with 85.10

This collaborative work by over 180 researchers from 40+ countries addresses the challenges posed by “phantom agents”—putative pathogenic agents named in literature without supporting data on their existence. Those agents remain on regulatory lists, creating barriers in trade and plant certification. Historically identified based solely on symptoms, these agents lack isolates or sequence data, making reliable detection or risk assessment impossible. After reviewing over 120 such agents across 10 key plant genera, we recommend their removal from regulatory lists and call for revised standards aligned with modern diagnostics. This effort seeks to streamline germplasm exchange, benefiting global agriculture by removing the constraints imposed by phantoms.

Citrus tristeza virus (CTV) causes economically important stem pitting in sensitive citrus types however the exact mechanisms of stem pitting development in citrus remain unclear. In this study, CTV infectious clones were used to study stem pitting induction in ‘Duncan’ grapefruit and ‘Mexican’ lime. A panel of open reading frame (ORF) replacement clones was generated focusing on the CTV ORFs implicated in stem pitting development and pathogenicity, namely p33, p18, p13 and p23. ORF replacements from severe- and mild-pitting CTV isolates were introduced into a mild-pitting infectious clone (genotype T36) to determine if stem pitting could be induced. A broad range of stem pitting outcomes were observed with ORF p18 (from isolate T3-KB) and ORF p23 (from isolate GFMS12-1.3) associated with enhanced stem pitting development. Metabolomic trends underlying the different stem pitting outcomes were further assessed by untargeted metabolite profiling. In each citrus host, the metabolite profiling identified statistically significant compounds that differed between stem pitting groups. These compounds were mainly phenolic acids and phenolic glycosides and are known to function as antioxidant and stress-signaling molecules. These metabolites can serve as targets for future time-course observations to potentially use mass spectrometry profiling to inform CTV management practices.

Agapanthus praecox Willd. is an ornamental flowering plant that is indigenous to southern Africa and was reported to be a host of tomato spotted wilt orthotospovirus (TSWV) in Australia in 2000 (Wilson et al. 2000). Tomato spotted wilt orthotospovirus (TSWV) belonging to the genus Orthotospovirus of the family Tospoviridae is a single-stranded negative sense RNA virus known to cause disease symptoms in many crops and ornamental plant species. This virus is in the top 10 of most economically important plant viruses worldwide (Rybicki 2015; Scholthof et al. 2011). In May 2021, leaf material from three agapanthus (Agapanthus praecox) plants displaying chlorotic mottling, and yellow lesions (Supplementary material 1A) was collected in Mbombela, South Africa. One gram of symptomatic leaf material was used for total RNA extraction from each of the three samples using a CTAB extraction protocol (Ruiz-García et al. 2019). The three RNA extracts were pooled, and a sequencing library was constructed using the Ion Total RNA-Seq Kit v2.0 and RiboMinus™ Plant Kit for RNA-Seq (ThermoFisher Scientific) (Central Analytical Facility (CAF), Stellenbosch University). The RNA library was sequenced on an Ion Torrent Proton Instrument (CAF). A total of 34,392,939 single-end reads were obtained. Data was trimmed for quality with Trimmomatic (CROP:250, MINLEN:50). De novo assembly was performed on the remaining 32,281,645 trimmed reads (average readlength: 100 nt, range: 50-250 nt) using SPAdes 3.13.0 and resulted in 4,788 contigs. BLASTn analysis identified viral contigs longer than 1,000 nucleotides (nts) with high nucleotide (nt) identity to TSWV (6 contigs), as well as to the newly discovered viruses, agapanthus tungro virus (AgTV) (1 contig), and agapanthus velarivirus (AgVV) (4 contigs) (Read et al 2021). Read mapping was performed against the relevant reference sequence with the highest nt identity to the contigs. For TSWV, 4995, 21221 and 14574 reads mapped to segment L (KY250488), M (KY250489) and S (KY250490) of isolate LK-1, respectively resulting in 99.97%, 100.00% and 99.97% genome coverage of the reference accessions. The nt identity between the reference accessions and the consensus sequences generated (OP921761-OP921763) were 97.26%, 97.64% and 97.82% for segment L, M and S. The presence of TSWV was confirmed in the HTS sample using an RT-PCR assay (primers L1 and L2) targeting the L segment of TSWV (Mumford et al. 1994). In July 2022, additional leaf samples displaying symptoms of chlorotic mottling, streaking, and ringspots were collected from 31 symptomatic and 3 asymptomatic agapanthus plants in public gardens in Stellenbosch, South Africa. Using the above-mentioned RT-PCR assay, 13 of the symptomatic samples tested positive for TSWV. All six plants displaying ring spot symptoms (Supplementary material 1B) were infected with TSWV. However, plants that displayed yellow streaking (five samples) and chlorotic mottling (two samples) (Supplementary material 1C-D) were also positive for TSWV which could be due to the presence of other viruses, plant growth stage, infection time or just variable symptom expression in a single host species as reported previously (Sherwood et al. 2003). The 275 bp RT-PCR amplicons of the HTS sample and three additional positive samples were validated with bidirectional Sanger sequencing (CAF) and had 96% identity to accession KY250488. The pairwise nt identity between amplicons was 98.55-100%. This is the first report of TSWV infecting agapanthus in South Africa. This study contributes information towards the distribution and incidence of TSWV and highlights the need for nurseries to screen plant material before propagation.

Recent developments in high-throughput sequencing (HTS) technologies and bioinformatics have drastically changed research in virology, especially for virus discovery. Indeed, proper monitoring of the viral population requires information on the different isolates circulating in the studied area. For this purpose, HTS has greatly facilitated the sequencing of new genomes of detected viruses and their comparison. However, bioinformatics analyses allowing reconstruction of genome sequences and detection of single nucleotide polymorphisms (SNPs) can potentially create bias and has not been widely addressed so far. Therefore, more knowledge is required on the limitations of predicting SNPs based on HTS-generated sequence samples. To address this issue, we compared the ability of 14 plant virology laboratories, each employing a different bioinformatics pipeline, to detect 21 variants of pepino mosaic virus (PepMV) in three samples through large-scale performance testing (PT) using three artificially designed datasets. To evaluate the impact of bioinformatics analyses, they were divided into three key steps: reads pre-processing, virus-isolate identification, and variant calling. Each step was evaluated independently through an original, PT design including discussion and validation between participants at each step. Overall, this work underlines key parameters influencing SNPs detection and proposes recommendations for reliable variant calling for plant viruses. The identification of the closest reference, mapping parameters and manual validation of the detection were recognized as the most impactful analysis steps for the success of the SNPs detections. Strategies to improve the prediction of SNPs are also discussed.

This datasheet on Candidatus Liberibacter africanus covers Identity, Overview, Distribution, Dispersal, Hosts/Species Affected, Vectors & Intermediate Hosts, Diagnosis, Biology & Ecology, Natural Enemies, Impacts, Prevention/Control, Further Information.

HomePlant DiseaseVol. 106, No. 2First Report of Coguvirus eburi Infecting Pear (Pyrus communis) in South Africa PreviousNext DISEASE NOTE OPENOpen Access licenseFirst Report of Coguvirus eburi Infecting Pear (Pyrus communis) in South AfricaK. Bougard, H. J. Maree, G. Pietersen, J. Meitz-Hopkins, and R. BesterK. BougardDepartment of Genetics, Stellenbosch University, Private Bag X1, Matieland, 7602, South AfricaSearch for more papers by this author, H. J. Mareehttps://orcid.org/0000-0001-9639-4558Department of Genetics, Stellenbosch University, Private Bag X1, Matieland, 7602, South AfricaCitrus Research International, PO Box 2201, Matieland, 7602, South AfricaSearch for more papers by this author, G. PietersenDepartment of Genetics, Stellenbosch University, Private Bag X1, Matieland, 7602, South AfricaSearch for more papers by this author, J. Meitz-Hopkinshttps://orcid.org/0000-0002-8127-6978Department of Plant Pathology, Stellenbosch University, Private Bag X1, Matieland, 7602, South AfricaSearch for more papers by this author, and R. Bester†Corresponding author: R. Bester; E-mail Address: rachelle@sun.ac.zahttps://orcid.org/0000-0002-2226-0968Department of Genetics, Stellenbosch University, Private Bag X1, Matieland, 7602, South AfricaCitrus Research International, PO Box 2201, Matieland, 7602, South AfricaSearch for more papers by this author AffiliationsAuthors and Affiliations K. Bougard1 H. J. Maree1 2 G. Pietersen1 J. Meitz-Hopkins3 R. Bester1 2 † 1Department of Genetics, Stellenbosch University, Private Bag X1, Matieland, 7602, South Africa 2Citrus Research International, PO Box 2201, Matieland, 7602, South Africa 3Department of Plant Pathology, Stellenbosch University, Private Bag X1, Matieland, 7602, South Africa Published Online:17 Jan 2022https://doi.org/10.1094/PDIS-08-21-1630-PDNAboutSectionsView articlePDFPDF Plus ToolsAdd to favoritesDownload CitationsTrack Citations ShareShare onFacebookTwitterLinked InRedditEmailWechat View articleCoguvirus eburi is a member of the genus Coguvirus in the family Phenuviridae (Kuhn et al. 2020). The species Coguvirus eburi was established to include citrus virus A (CiVA), which is a negative-sense, single-stranded RNA virus that was first found infecting sweet orange in southern Italy via high-throughput sequencing (HTS) (Navarro et al. 2018). This virus was also found to infect pome fruits in France, such as pear (Svanella-Dumas et al. 2019). More recently, CiVA infections have been associated with impietratura disease in citrus (Beris et al. 2021). In the summer of 2021, leaf samples were collected from a pear tree (Pyrus communis cv. Bosc, B175) in the Koue Bokkeveld, South Africa, as part of a virus survey. Sample B175 displayed no visual disease symptoms. One gram of leaf petioles was used for total RNA extraction, using a modified CTAB extraction protocol (Ruiz-García et al. 2019). Ribo-depleted RNA was prepared (Ribo-Zero Plant kit) and a sequencing library constructed (Illumina TruSeq Stranded Total RNA). The RNA library was paired-end (2 × 100 bp) sequenced on an Illumina HiSeqX instrument (Macrogen, South Korea). A total of 47,750,152 reads were obtained. Raw data were trimmed for quality with Trimmomatic (SLIDINGWINDOW:3:20, MINLEN:20) (Bolger et al. 2014). De novo assembly performed with CLC Genomics Workbench 11.0.1 (Qiagen) (default parameters) using high quality reads yielded 75,250 contigs. BLASTn analysis identified two viral contigs with high nucleotide (nt) identity to apple stem pitting virus (ASPV) and CiVA. The CiVA contig was 9,400 nt and on closer examination, a concatemer of CiVA RNA1 and RNA2. The concatenation occurred due to the characteristic near-identical nucleotides shared at the 5′ and 3′ ends of RNA1 and RNA2 of these negative-stranded RNA viruses (Navarro et al. 2018). After splitting and curation, the RNA1 contig was 6,664 nt and the RNA2 contig 2,686 nt. A total of 51,397 and 34,820 reads were used to construct these contigs, resulting in an average depth of coverage of 761 and 1,281 for RNA1 and RNA2, respectively. The contigs had the highest nt identity to the complete CiVA GenBank accessions MT720885.1 (95.53%) and MW148460.1 (96.03%), spanning 99.6% and 98.1% of the genomes of RNA1 and RNA2, respectively. These contigs were submitted as partial genomes to GenBank as accessions MZ463039 and MZ463040. RT-PCR was used to validate the presence of CiVA in sample B175. Two RT-PCR assays, directed at RNA1 and RNA2, respectively (Bester et al. 2021), were used to generate amplicons. Amplicon sequences were confirmed with bidirectional Sanger sequencing. Twenty-one additional samples from the same orchard as B175 as well as other samples from the Koue Bokkeveld and Elgin areas, including cultivars Abate (10 samples), Forelle (10 samples), Early Bon Chretien (3 samples), Packham’s Triumph (12 samples), and Rosemarie (3 samples), were all surveyed for CiVA using the same RT-PCR assays as mentioned above. Thirty-six of the 59 samples tested were positive for CiVA, which further confirms the presence and widespread distribution of this virus in the limited survey conducted in pears in South Africa. However, no association with any disease symptoms or specific cultivar were identified. This is the first report of CiVA infecting pear in South Africa. This study therefore contributed to investigating the distribution of this virus and will assist the South African plant material certification scheme to assess the incidence of CiVA in South Africa.The author(s) declare no conflict of interest.References:Beris, D., et al. 2021. Phytopathology 111:1782. https://doi.org/10.1094/PHYTO-01-21-0027-R Link, ISI, Google ScholarBester, R., et al. 2021. J. Citrus Pathol. 8. https://doi.org/10.5070/C481049000 Crossref, Google ScholarBolger, A. M., et al. 2014. Bioinformatics 30:2114. Crossref, ISI, Google ScholarKuhn, J. H., et al. 2020. Arch. Virol. 165:3023. https://doi.org/10.1007/s00705-020-04731-2 Crossref, ISI, Google ScholarNavarro, B., et al. 2018. Front. Microbiol. 9:2340. https://doi.org/10.3389/fmicb.2018.02340 Crossref, ISI, Google ScholarRuiz-García, A. B., et al. 2019. Page 163 in: Citrus Tristeza Virus. Methods in Molecular Biology. Humana, New York. https://doi.org/10.1007/978-1-4939-9558-5_12 Crossref, Google ScholarSvanella-Dumas, L., et al. 2019. Plant Dis. 103:2703. https://doi.org/10.1094/PDIS-01-19-0028-PDN Link, ISI, Google ScholarFunding: The project was funded by Hortgro (PO-20-USGEN-PM01).The author(s) declare no conflict of interest.DetailsFiguresLiterature CitedRelated Vol. 106, No. 2 February 2022SubscribeISSN:0191-2917e-ISSN:1943-7692 DownloadCaptionWater-soaked lesions on bougainvillea caused by Robbsia andropogonis (O. Morales-Galván et al.). Photo credit: L. F. Flores-López. Soybean leaf showing crinkling and downward curling, characteristic of infection by soybean mosaic virus (SMV) (S. van Bentum et al.). Photo credit: S. van Bentum. Metrics Downloaded 230 times Article History Issue Date: 28 Feb 2022Published: 17 Jan 2022First Look: 29 Aug 2021Accepted: 26 Aug 2021 Page: 772 Information© 2022 The American Phytopathological SocietyFundingHortgroGrant/Award Number: PO-20-USGEN-PM01KeywordsCiVAcitrus virus Aviruses and viroidstree fruitsThe author(s) declare no conflict of interest.Cited ByIdentification and Characterization of Citrus Concave Gum-Associated Virus Infecting Citrus and Apple Trees by Serological, Molecular and High-Throughput Sequencing Approaches5 November 2021 | Plants, Vol. 10, No. 11

Plum viroid I (PlVd-I) was recently identified as a new viroid in 2020 present in Japanese plum (Prunus salicina) displaying marbling and corky flesh symptoms (Bester et al. 2020). This viroid is a member of the species Apscaviroid plvd-I (genus Apscaviroid, family Pospiviroidae) (Walker et al. 2022). The first observation of apricot fruits with an uneven, indented surface and irregular shape was in 2003 on Prunus armeniaca cv. Charisma in the Western Cape, South Africa. The symptomatic apricot cv 'Charisma' scions showed symptoms only on the fruits, resembling the marbling disease deformities reported previously on fruits from PlVd-I-infected plum trees (Supplementary material 1). In the summer of 2019, representative leaf samples were collected from 13 'Charisma' apricot trees (seven symptomatic and six healthy trees) from two different apricot orchards on two geographical separate farms in the Western Cape. Total RNA was extracted from 1 g leaf petioles using a modified CTAB extraction protocol (Ruiz-García et al. 2019). Ribo-depleted RNA (RiboMinus™ Plant Kit for RNA-Seq, ThermoFisher Scientific) was prepared, and a sequencing library (Ion Total RNA-Seq Kit v2.0, ThermoFisher Scientific) was constructed from a symptomatic sample (La4) (Central Analytical Facility, Stellenbosch University, CAF-SU). High-throughput sequencing was performed on an Ion Torrent™ Proton™ instrument (CAF-SU). De novo assembly using SPAdes 3.13.0 (default parameters) (Nurk et al. 2013) were performed using 93,760,198 reads (average read length: 143 nt). The 174679 scaffolds obtained were annotated using BLAST+ standalone against a local NCBI nucleotide database. One scaffold (443 nt, read coverage: 23.88) had the highest sequence identity (99.59%) to multiple PlVd-I isolates and two scaffolds of 1440 nucleotides (nt) and 2143 nt had high sequence identity to RNA1 and RNA2 of solanum nigrum ilarvirus 1 (SnIV1) (MN216370: 98%; MN216373: 98%) (Ma et al. 2020). These were the only viral sequences identified in the sample. Consensus sequences for SnIV1 were generated by read mapping using CLC Genomics Workbench 11.0.1 (Qiagen) (default parameters) to SnIV1 (MN216370; MN216373; MN216376) and deposited in GenBank (MT900926-MT900928). To confirm the presence of both PlVd-I and the apricot variant of SnIV1, reverse transcription polymerase chain reactions (RT-PCRs) were performed on the RNA of the 13 samples collected. The samples were tested for PlVd-I using primer set 22F/21R (Bester et al. 2020). Only the symptomatic samples tested positive for PlVd-I providing the first evidence of PlVd-I related symptoms in apricots. Three PlVd-I amplicons were bidirectionally Sanger sequenced (CAF-SU) and submitted to GenBank (MT385845-MT385847). The HTS PlVd-I sequence from sample La4 was 100% identical to MT385845, and 99.37% identical to MT385846 and MT385847. An RT-PCR assay was designed, targeting SnIV1 RNA2 (Ilar_RNA2_402F: CTATCTGCCCGAAGGTCAAC, Ilar_RNA2_1161R: CCTATCAAGAGCGAGCAATGG). All samples tested positive for SnIV1 irrespective of symptom status and therefor SnIV1 appears not be associated with specific symptoms in 'Charisma' apricots. This study is the first to report the presence of PlVd-I in symptomatic apricots presenting with uneven, indented surface morphology in South Africa. This study adds towards the investigation into possible alternative hosts for PlVd-I and will assist the South African certification scheme to assess the incidence and severity in apricots.

Huanglongbing (HLB, Asian Citrus Greening), the most devastating disease of citrus has not been detected in southern Africa (Gottwald, 2010). HLB is associated with 'Candidatus Liberibacter asiaticus' (CLas), a phloem-limited bacterium vectored by Diaphorina citri Kuwayama (Hemiptera: Liviidae), the Asian Citrus Psyllid (ACP). African Citrus Greening, associated with 'Candidatus Liberibacter africanus' (CLaf) and its vector the African Citrus Triozid, Trioza erytreae (Del Guercio) (Hemiptera: Triozidae), are endemic to Africa, although not previously reported from Angola. African Greening is less severe than HLB, largely due to heat sensitivity of CLaf and its vector. Introduction of HLB into southern Africa would be devastating to citrus production in commercial and informal sectors. Concern was raised that CLas or ACP might hae inadvertently been introduced into Angola. In July 2019, a survey was conducted in two citrus nurseries in Luanda and Caxito and in different orchards on 7 farms surrounding Calulo and Quibala. Yellow sticky traps for insects were placed at the various localities and collected after c. 3 weeks. Breeding signs of T. erytreae (pit galls) were observed on citrus in some locations, but no insect vectors were detected on traps. Trees were inspected for signs and symptoms of citrus pests and diseases, particularly those that resemble HLB (foliar blotchy mottle, shoot chlorosis, vein yellowing and corking, lopsided fruit with aborted seeds and colour inversion) and its vectors (pit galls on leaves or waxy exudates). Leaves and shoots with suspect symptoms were sampled for laboratory analysis (43 samples). DNA was extracted from petiole and midrib tissue of leaves using a modified CTAB extraction protocol of Doyle and Doyle (1990). Real-time PCR was done using universal Liberibacter primers of Roberts et al. (2015), CLaf specific primers of Li et al. (2006) and CLas specific primers of Bao et al. (2019). All real-time PCR protocols indicated the presence of CLaf in 6 samples (Tab. S1). CLas or other citrus Liberibacter species were not detected. The presence of CLaf in sample 37 was confirmed by constructing a library (NEXTFLEX® DNA Sequencing Kit, PerkinElmer) with extracted DNA and performing high-throughput sequencing on an Ion Torrent™ S5™ platform (Central Analytical Facility, Stellenbosch University). To improve the quality of the reads, all 233,617,700 obtained reads were trimmed from the 3' end to a maximum length of 240 nt using Trimmomatic (Bolger et al. 2014). The high quality reads were mapped to the Citrus sinensis reference genome (NC_023046.1) using Bowtie 2.3.4 (Langmead and Salzberg 2012) to subtract all the reads that had high identity to the host plant (number of mismatches allowed in the seed was set to 1). The 14,691,369 unmapped reads (6.2% of original data) were mapped to the CLaf reference genome NZ_CP004021.1 using CLC Genomics Workbench 10.1.1 (Qiagen) (Length fraction = 0.8; Similarity fraction = 0.9). A CLaf consensus genome was generated that spanned 99.7% of the reference genome and the 163001 mapped reads had a 22.9 mean read coverage. The consensus sequence was 99.7% identical to NZ_CP004021.1 and was submitted to Genbank as accession: CP054879. The positive CLaf detections were from trees with typical HLB or African Citrus Greening symptoms, viz. lopsided fruit with green stylar ends, aborted seed and stained columella at base of fruit button; yellow shoots with leaves showing symptoms of blotchy mottle and vein yellowing and corking (Fig. S1) in a commercial citrus farm outside Calulo and included 2 'Ponkan' mandarin (C. reticulata), 2 Valencia and 1 'Navelina' tree (C. sinensis), and a citrus nursery in Luanda (1 lime tree; C. aurantifolia) (Tab. S1). This first report of CLaf in Angola highlights the need to prevent spread by removing infected trees and managing the insect vector, as well as the need for further surveys to determine the occurrence of African Greening and its vectors in other provinces and to confirm the absence of exotic citrus pests and diseases. References Bao, M. et al. 2020. Plant Dis. 104:527 Bolger, A. M. et al. 2014. Bioinformatics. 30:2114-2120. Doyle, J.J. and Doyle, J.L. 1990. Focus 12:13 Gottwald, T.R. 2010. Annu. Rev. Phytopathol. 48:119 Langmead, B. and Salzberg, S. 2012. Nature Methods. 9:357-359. Li, W. et al. 2006. Jnl. Microbiol. Methods 66:104 Roberts, R. et al. 2015. Int. J. Syst. Evol. Micr. 65:723.

HomePlant DiseaseVol. 104, No. 11First Report of Plum Bark Necrosis Stem Pitting-Associated Virus in Japanese Plums in South Africa PreviousNext DISEASE NOTES OPENOpen Access licenseFirst Report of Plum Bark Necrosis Stem Pitting-Associated Virus in Japanese Plums in South AfricaR. Bester and H. J. MareeR. Besterhttp://orcid.org/0000-0002-2226-0968Department of Genetics, Stellenbosch University, Matieland, 7602, South AfricaCitrus Research International, Matieland, 7602, South Africa and H. J. Maree†Corresponding author: H. J. Maree; E-mail Address: [email protected]http://orcid.org/0000-0001-9639-4558Department of Genetics, Stellenbosch University, Matieland, 7602, South AfricaCitrus Research International, Matieland, 7602, South AfricaAffiliationsAuthors and Affiliations R. Bester1 2 H. J. Maree1 2 † 1Department of Genetics, Stellenbosch University, Matieland, 7602, South Africa 2Citrus Research International, Matieland, 7602, South Africa Published Online:1 Sep 2020https://doi.org/10.1094/PDIS-04-20-0710-PDNAboutSectionsPDF ToolsAdd to favoritesDownload CitationsTrack Citations ShareShare onFacebookTwitterLinked InRedditEmailWechat Plum bark necrosis stem pitting disease was first reported in 1996 on Japanese plum (Prunus salicina) cultivar Black Beaut when graft-inoculated trees developed disease symptoms (Uyemoto and Teviotdale 1996). The potential causal agent was identified to be Plum bark necrosis stem pitting-associated virus, a member of the genus Ampelovirus in the family Closteroviridae (Marini et al. 2002; Martelli et al. 2012). Symptoms associated with plum bark necrosis stem pitting-associated virus (PBNSPaV) are host dependent and include bark necrosis and stem pitting (Boscia et al. 2011); however, latent infections have also been observed in sweet cherry and apricot (García-Ibarra et al. 2010; Ruiz-García et al. 2020). In the summer of 2018, a representative sample was collected from a P. salicina cv. Angeleno tree (LH4) in the Western Cape, South Africa, and total RNA was extracted from 1 g of leaf petioles using a modified CTAB extraction protocol (Ruiz-García et al. 2019). Ribo-depleted RNA was prepared (Ribo-Zero Plant kit) and a sequencing library constructed (Illumina TruSeq Stranded Total RNA). The RNA library was paired-end (2 × 100 bp) sequenced on an Illumina NovaSeq instrument (Macrogen, South Korea). Quality-trimmed data (26.4 million read pairs) were used in a de novo assembly using SPAdes version 3.14 (Nurk et al. 2013) (coverage cutoff = 20). BLASTn analysis found 34 PBNSPaV-related contigs from 29,332 assembled. The longest contig (14,209 nucleotides [nt]) had an average read depth of 88.5, indicating the presence of PBNSPaV in sample LH4. This contig had the highest nt sequence identity to isolate PR258-2 (KC590346) (98.95%), spanning 99.83% of the genome. Contigs with the closest nt similarity (∼98 and ∼92%) to accessions EF546442 and KU240013, respectively, were also identified, signifying the potential presence of three PBNSPaV variants in a single tree. Simultaneous read mapping to the three accessions (KC590346, EF546442, and KU240013) was performed using CLC Genomics Workbench 11.0.1 (Qiagen) (length fraction = 0.9, similarity fraction = 0.9; reads with more than one match were assigned randomly). A total of 80,405 reads mapped to KC590346, EF546442, and KU240013, representing 43.74, 39.79, and 16.47% of the mapped reads. The consensus sequence obtained after mapping the reads to KC590346 spanned 99.84% of the KC590346 genome. This consensus sequence was submitted to GenBank as a near-complete genome of 14,197 nt (MT271231). The consensus sequences generated from mapping the reads to EF546442 and KU240013 had 97.29 and 95.29% nt identity to the respective references and spanned 99.79 and 76.46% of the genomes, respectively. These two consensus sequences had 96% nt sequence similarity and were 83.12 and 86.49% similar to MT271231. No other virus- or viroid-related contigs were identified in the sample. To validate the presence of PBNSPaV in sample LH4, reverse transcription polymerase chain reaction (RT-PCR) was used to amplify a partial region of P61 using primers PBN-F1 and PBN-R1 (Marais et al. 2014). The 319-bp amplicon was bidirectionally Sanger sequenced (Central Analytical Facility, Stellenbosch University) and additionally confirmed PBNSPaV in sample LH4. Ten additional samples from the same orchard as LH4, 10 samples from a different Angeleno orchard on the same farm, and 19 Angeleno samples from a young orchard on a different farm in the Western Cape were sampled and screened using the PBN-F1/PBN-R1 RT-PCR assay. Thirty-eight of these samples were positive for PBNSPaV, further confirming the presence of the virus in Japanese plum cultivar Angeleno in South Africa. No stem pitting and bark symptoms were observed in any of the trees analyzed. To our knowledge, this is the first report of PBNSPaV infecting Japanese plums in South Africa. This study adds information on the distribution of this pathogen and will contribute to the updating of the South African certification scheme.The author(s) declare no conflict of interest.References:Boscia, D., et al. 2011. Page 177 in: Virus and Virus-Like Diseases of Pome and Stone Fruits. American Phytopathological Society, St. Paul, MN. https://doi.org/10.1094/9780890545010.034 Link, Google ScholarGarcía-Ibarra, A., et al. 2010. Plant Dis. 94:275. https://doi.org/10.1094/PDIS-94-2-0275A Link, ISI, Google ScholarMarais, A., et al. 2014. Phytopathology 104:660. https://doi.org/10.1094/PHYTO-08-13-0229-R Link, ISI, Google ScholarMarini, D. B., et al. 2002. Plant Dis. 86:415. https://doi.org/10.1094/PDIS.2002.86.4.415 Link, ISI, Google ScholarMartelli, G. P., et al. 2012. J. Plant Pathol. 94:7. https://doi.org/10.4454/jpp.fa.2012.022 ISI, Google ScholarNurk, S., et al. 2013. Page 158 in: Research in Computational Molecular Biology. Springer, Berlin, Germany. https://doi.org/10.1007/978-3-642-37195-0 Crossref, Google ScholarRuiz-García, A. B., et al. 2019. Page 163 in: Citrus Tristeza Virus. Humana, New York, NY. https://doi.org/10.1007/978-1-4939-9558-5_12 Crossref, Google ScholarRuiz-García, A. B., et al. 2020. Plant Dis. 104:602. https://doi.org/10.1094/PDIS-07-19-1567-PDN Link, ISI, Google ScholarUyemoto, J. K., and Teviotdale, B. L. 1996. Phytopathology 86:S111. Google ScholarThe author(s) declare no conflict of interest.Funding: The project was funded by Hortgro (GenUS18-Stone).DetailsFiguresLiterature CitedRelated Vol. 104, No. 11 November 2020SubscribeISSN:0191-2917e-ISSN:1943-7692 DownloadCaptionPlants of Echinacea purpurea affected by Verticillium dahliae (A. Garibaldi et al.). Photo credit: M. L. Gullino. Spinach plant infected with Stemphylium leaf spot (K. A. Spawton et al.). Photo credit: M. T. McGrath. Metrics Article History Issue Date: 30 Oct 2020Published: 1 Sep 2020First Look: 27 May 2020Accepted: 22 May 2020 Page: 3087 Information© 2020 The American Phytopathological SocietyFundingHortgroGrant/Award Number: GenUS18-StoneKeywordsPBNSPaVhigh-throughput sequencingstone fruitThe author(s) declare no conflict of interest.PDF downloadCited byHigh-Throughput Sequencing Application in the Diagnosis and Discovery of Plant-Infecting Viruses in Africa, A Decade Later16 October 2020 | Plants, Vol. 9, No. 10

Since the establishment of the genus Vitivirus, several additional viruses have been sequenced and proposed to represent new species of this genus. Currently, the International Committee on Taxonomy of Viruses recognizes 15 vitivirus species. The report of new vitiviruses that fail to completely adhere to the species demarcation criteria, the incorporation of non-vitivirus grapevine viruses in the unofficial "naming system", and the existence of non-grapevine vitiviruses lead to inconsistencies in classification. In this report, we give a brief overview of vitiviruses and use currently available information to clarify the present status of the vitivirus taxonomy.

Grapevine leafroll disease (GLD) is present in all grape-growing regions of the world and is considered the most significant grapevine viral disease. Grapevine leafroll-associated virus 3 (GLRaV-3) is considered the primary cause of GLD and in South African vineyards five genetic variant groups (I, II, III, VI and VII) have been confirmed. Biological distinctions between GLRaV-3 variants have not been fully validated. By characterising virus concentration and stress-responsive microRNA expression in GLRaV-3 infected plants, this study aimed to glean a better understanding of the possible biological distinctions between GLRaV-3 variants. Quantitative reverse transcription PCR was utilised for virus concentration ratio (VCR) determination and miRNA quantitation in GLRaV-3 positive and negative grapevines grown under greenhouse and field conditions. This study found statistically significant differences in VCRs in plants singly infected with different GLRaV-3 variants. Interestingly, no difference in mean VCRs were observed between data sets, despite notable differences in plant age, duration of GLRaV-3 infection, scion/ rootstock combination and growing conditions. Several miRNAs showed statistically significant expression modulation between infected and healthy samples. miRNA expression between data sets varied substantially and a greater overall miRNA response was observed in plants with more established GLRaV-3 infections. The lack of significant differences in mean VCRs between data sets, coupled with the consistent modulation of certain miRNAs in plants that have likely been infected for longer is a promising result. This finding could indicate that successful inhibition of further virus replication by plant defence mechanisms occurred, and that these miRNAs are implicated in this response.

In South Africa, there is a newfound interest in old vineyards, and the exceptional wines produced from them. These wines are generally accepted as having more depth and complexity than young-vineyard wines, thus the term "old vine" tends to be used on wine labels as an indication of a superior, high-quality wine. However, there is only anecdotal evidence that these wines are truly of a higher standard. This study is the first scientific research into the so-called "old-vine" wine character, aiming to determine any significant differences in gene expression in leaves and berries of young and old clonal vines, at the time of harvest. Gene expression of 40-year-old and 7-year-old vines, growing in a commercial 'Pinotage' vineyard, and used for the production of such premium wines, was analysed as the first step towards elucidating the origins of the old-vine character. RNA-seq analysis identified 925 genes differentially expressed between young and old vines. Many of these transcripts are involved in metabolic pathways active during fruit ripening. A general trend was observed towards delayed berry ripening in old vines. Berries of these vines also had a lower sugar concentration and higher titratable acids at the time of harvest compared with young-vine berries. Collectively, these results would suggest that berries of old vines take longer to ripen, possibly allowing for the accumulation of volatile aromas that influence berry flavour.

Ornithogalum thyrsoides, commonly known as chincherinchee, is an indigenous ornamental plant widely cultivated in South Africa. It is commercially valued as a flowering pot plant and for the production of cut flowers. Virus infections resulting in the development of severe necrotic mosaic symptoms threaten the success of commercial cultivation. The virome of an O. thyrsoides plant displaying necrotic mosaic symptoms was determined using high-throughput sequencing (HTS). In this plant, ornithogalum mosaic virus and ornithogalum virus 3 were identified, as well as a previously unknown virus. The full genome sequence of this virus was confirmed by Sanger sequencing using overlapping amplicons combined with rapid amplification of cDNA ends (RACE). Based on genome organisation and phylogenetic analysis, this novel virus can be classified as a polerovirus.

High‐throughput sequencing (HTS) technologies have revolutionized plant pest research and are now raising interest for plant pest diagnostics, with plant virus diagnostics at the forefront of development. However, the application of HTS in plant pest diagnostics raises important challenges that plant health regulators will have to address. Adapted infrastructures, technical guidelines and training are pivotal for further use and adoption of the HTS technologies in the phytosanitary framework.

The conservation of plant biosecurity relies on the rapid identification of pathogenic organisms, including viruses. With next-generation sequencing (NGS), it is possible to identify multiple viruses within a metagenomic sample. In this study, we explored the use of electronic probes (e-probes) for the simultaneous detection of 11 recognized citrus viruses. E-probes were designed and screened against raw sequencing data to minimize the bioinformatic processing time required. The e-probes were able to accurately detect their cognate viruses in simulated datasets, without any false negatives or positives. The efficiency of the e-probe-based approach was validated with NGS datasets generated from different RNA preparations: double-stranded RNA (dsRNA) from ‘Mexican’ lime infected with different Citrus tristeza virus (CTV) genotypes, dsRNA from field samples, and small RNA and total RNA from grapefruit infected with the CTV T3 genotype. A set of probes was made available that is able to accurately detect CTV in sequence data regardless of the input dataset or the genotype that plants are infected with.