Introduction: We evaluated risk factors and demographic characteristics of associated with mild cognitive impairment (MCI) in patients with COPD. Methods: 220 individuals with COPD enrolled in a cohort study designed to evaluate anxiety conducted at 16 clinical centers. Cognitive impairment was assessed with the Montreal Cognitive Assessment (MoCA), a cutoff score of <26 defined as MCI. Data were collected including spirometry, 6-minute walk test, symptom burden by COPD Assessment Test and dyspnea by Modified Medical Research Council, anxiety measured by Anxiety Inventory of Respiratory Disease, Generalized Anxiety Disorder-7 and Hospital Anxiety Depression Scale, depression by Patient Health Questionnaire-9 and health status by Patient Reported Outcomes Measurement Information System and sleep quality by the Pittsburg Sleep Quality Index. Results: The median age was 65 years and 54% of participants were male. 119(54%) of participants had MCI as classified by MoCA. In multivariable logistic regression, higher odds ratios (OR) (95% confidence interval) for MCI (MoCA) <26 were associated with increased years of age, 1.06 (1.02 -1-09, p<0.003); African-American race, 3.68(1.67-8.11, p<0.001); persistent phlegm, 2 (1.12-3.57, p<0.01) and sleep disturbance, 1.04(1.01-1.08, p<0.01). Conclusions: COPD patients commonly screen positive for MCI. Characteristics associated with MCI included age, African-American race, sleep disturbance and persistent phlegm.

Rationale: Anxiety is a common comorbidity of chronic obstructive pulmonary disease (COPD) that is associated with higher morbidity and mortality.We evaluated three anxiety screening questionnaires: the Generalized Anxiety Disorder 7-Item Scale (GAD-7), the Hospital Anxiety and Depression Scale Anxiety subscale (HADS-A), and the Anxiety Inventory for Respiratory Disease (AIR).Objectives: To evaluate and compare the test performance characteristics of three anxiety screening questionnaires, using the Mini-International Neuropsychiatric Interview (MINI), version 7.0, as the "gold standard."Methods: Individuals with COPD were recruited at 16 centers.The MINI and questionnaires were administered by trained research coordinators at an in-person visit and readministered by telephone 2-4 weeks later.A composite score for the presence of any Diagnostic and Statistical Manual of Mental Disorders, 5th edition (DSM-V) anxiety disorder was computed, based on the MINI as the gold standard, compared with a participant screening positive on self-report measures for these analyses.Results: Two hundred and twenty eligible individuals with COPD were enrolled; 219 completed the study.Eleven percent were identified as having a DSM-V anxiety disorder, based on the MINI.Elevated anxiety symptoms based on questionnaires were 38% for the AIR, 30% for the GAD-7, and 20% for the HADS-A.Area under the receiver operating characteristic curve (AUC) was highest for the GAD-7 (0.78; 95% confidence interval [CI], 0.69-0.87),followed by the HADS-A (0.74; 95% CI, 0.64-0.84)and the AIR (0.66; 95% CI, 0.56-0.76).The AUC for the GAD-7 was significantly greater than for the AIR (P = 0.014).Sensitivity was not statistically different among the questionnaires: 77% for the GAD-7, 63% for the HADS-A, and 66% for the AIR.The HADS-A had the highest specificity, 85%, which was significantly higher than that of the GAD-7 (77%; P , 0.001) and the AIR (65%; P , 0.001); GAD-7 specificity was higher than AIR specificity (P , 0.001).Conclusions: Symptoms of anxiety among patients with COPD as identified by screening questionnaires were common and significantly higher than the prevalence of anxiety disorder meeting DSM-V criteria.The GAD-7, the HADS-A and the AIR questionnaires had fair to moderate psychometric properties as screening tools for anxiety in individuals with COPD, indicating the need for improved measures for this patient population.

RATIONALEThe small conducting airways are the major site of airflow obstruction in chronic obstructive pulmonary disease and may precede emphysema development.OBJECTIVESWe hypothesized a novel computed tomography (CT) biomarker of small airway disease predicts FEV1 decline.METHODSWe analyzed 1,508 current and former smokers from COPDGene with linear regression to assess predictors of change in FEV1 (ml/yr) over 5 years. Separate models for subjects without and with airflow obstruction were generated using baseline clinical and physiologic predictors in addition to two novel CT metrics created by parametric response mapping (PRM), a technique pairing inspiratory and expiratory CT images to define emphysema (PRM(emph)) and functional small airways disease (PRM(fSAD)), a measure of nonemphysematous air trapping.MEASUREMENTS AND MAIN RESULTSMean (SD) rate of FEV1 decline in ml/yr for GOLD (Global Initiative for Chronic Obstructive Lung Disease) 0-4 was as follows: 41.8 (47.7), 53.8 (57.1), 45.6 (61.1), 31.6 (43.6), and 5.1 (35.8), respectively (trend test for grades 1-4; P < 0.001). In multivariable linear regression, for participants without airflow obstruction, PRM(fSAD) but not PRM(emph) was associated with FEV1 decline (P < 0.001). In GOLD 1-4 participants, both PRM(fSAD) and PRM(emph) were associated with FEV1 decline (P < 0.001 and P = 0.001, respectively). Based on the model, the proportional contribution of the two CT metrics to FEV1 decline, relative to each other, was 87% versus 13% and 68% versus 32% for PRM(fSAD) and PRM(emph) in GOLD 1/2 and 3/4, respectively.CONCLUSIONSCT-assessed functional small airway disease and emphysema are associated with FEV1 decline, but the association with functional small airway disease has greatest importance in mild-to-moderate stage chronic obstructive pulmonary disease where the rate of FEV1 decline is the greatest. Clinical trial registered with www.clinicaltrials.gov (NCT 00608764).

We have used a proteomic approach to identify novel mediators of inflammation in the sputum of a subject with asthma compared with a healthy control subject (see this article's MethodsE1Adams D. Larman B. Oxburgh L. Developmental expression of mouse follistatin-like 1 (Fstl1): dynamic regulation during organogenesis of the kidney and lung.Gene Expr Patterns. 2007; 7: 491-500Crossref PubMed Scopus (65) Google Scholar, E2Chan Q.K. Ngan H.Y. Ip P.P. Liu V.W. Xue W.C. Cheung A.N. Tumor suppressor effect of follistatin-like 1 in ovarian and endometrial carcinogenesis: a differential expression and functional analysis.Carcinogenesis. 2009; 30: 114-121Crossref PubMed Scopus (76) Google Scholar section in the Online Repository at www.jacionline.org). Using this approach, we determined that follistatin-like 1 (FSTL1) is more than 200-fold highly expressed in the subject with asthma compared with the control subject and was the most highly expressed of the 508 proteins we examined in sputum. FSTL1, a 308 amino acid extracellular glycoprotein that shares 94% identity in man and mouse,1Chaly Y. Hostager B. Smith S. Hirsch R. Follistatin-like protein 1 and its role in inflammation and inflammatory diseases.Immunol Res. 2014; 59: 266-272Crossref PubMed Scopus (71) Google Scholar, 2Sylva M. Moorman A.F. van den Hoff M.J. Follistatin-like 1 in vertebrate development.Birth Defects Res. 2013; 99: 61-69Crossref PubMed Scopus (17) Google Scholar is generated by nonhematopoietic cells such as cells of the mesenchymal lineage (fibroblasts, chondrocytes, osteocytes, adipocytes, cardiomyocytes) by stimuli including TGF-β, IL-1β, TNF-α, and IL-6.1Chaly Y. Hostager B. Smith S. Hirsch R. Follistatin-like protein 1 and its role in inflammation and inflammatory diseases.Immunol Res. 2014; 59: 266-272Crossref PubMed Scopus (71) Google Scholar, 2Sylva M. Moorman A.F. van den Hoff M.J. Follistatin-like 1 in vertebrate development.Birth Defects Res. 2013; 99: 61-69Crossref PubMed Scopus (17) Google Scholar FSTL1 released from these mesenchymal cells targets immune cells (monocytes, macrophages, and T cells) to express proinflammatory cytokines (IL-1β, TNF-α, IL-6, IFN-γ) and chemokines (IL-8, MCP1, IP10).1Chaly Y. Hostager B. Smith S. Hirsch R. Follistatin-like protein 1 and its role in inflammation and inflammatory diseases.Immunol Res. 2014; 59: 266-272Crossref PubMed Scopus (71) Google Scholar FSTL1 has been studied in embryogenesis,E1Adams D. Larman B. Oxburgh L. Developmental expression of mouse follistatin-like 1 (Fstl1): dynamic regulation during organogenesis of the kidney and lung.Gene Expr Patterns. 2007; 7: 491-500Crossref PubMed Scopus (65) Google Scholar tumor development,E2Chan Q.K. Ngan H.Y. Ip P.P. Liu V.W. Xue W.C. Cheung A.N. Tumor suppressor effect of follistatin-like 1 in ovarian and endometrial carcinogenesis: a differential expression and functional analysis.Carcinogenesis. 2009; 30: 114-121Crossref PubMed Scopus (76) Google Scholar cardiac disease,E3Le Luduec J.B. Condamine T. Louvet C. Thebault P. Heslan J.M. Heslan M. et al.An immunomodulatory role for follistatin-like 1 in heart allograft transplantation.Am J Transplant. 2008; 8: 2297-2306Crossref PubMed Scopus (45) Google Scholar arthritis,E4Miyamae T. Marinov A.D. Sowders D. Wilson D.C. Devlin J. Boudreau R. et al.Follistatin-like protein-1 is a novel proinflammatory molecule.J Immunol. 2006; 177: 4758-4762Crossref PubMed Scopus (99) Google Scholar, E5Clutter S.D. Wilson D.C. Marinov A.D. Hirsch R. Follistatin-like protein 1 promotes arthritis by up-regulating IFN-gamma.J Immunol. 2009; 182: 234-239Crossref PubMed Scopus (80) Google Scholar bleomycin-induced lung fibrosis,E6Dong Y. Geng Y. Li L. Li X. Yan X. Fang Y. et al.Blocking follistatin-like 1 attenuates bleomycin-induced pulmonary fibrosis in mice.J Exp Med. 2015; 212: 235-252Crossref PubMed Scopus (112) Google Scholar and wound healing.E7Sundaram G.M. Common J.E. Gopal F.E. Srikanta S. Lakshman K. Lunny D.P. et al.‘See-saw’ expression of microRNA-198 and FSTL1 from a single transcript in wound healing.Nature. 2013; 495: 103-106Crossref PubMed Scopus (151) Google Scholar The predominant effect of FSTL1 appears to be proinflammatory,E4Miyamae T. Marinov A.D. Sowders D. Wilson D.C. Devlin J. Boudreau R. et al.Follistatin-like protein-1 is a novel proinflammatory molecule.J Immunol. 2006; 177: 4758-4762Crossref PubMed Scopus (99) Google Scholar, E5Clutter S.D. Wilson D.C. Marinov A.D. Hirsch R. Follistatin-like protein 1 promotes arthritis by up-regulating IFN-gamma.J Immunol. 2009; 182: 234-239Crossref PubMed Scopus (80) Google Scholar, E8Chaly Y. Marinov A.D. Oxburgh L. Bushnell D.S. Hirsch R. FSTL1 promotes arthritis in mice by enhancing inflammatory cytokine/chemokine expression.Arthritis Rheum. 2012; 64: 1082-1088Crossref PubMed Scopus (58) Google Scholar although anti-inflammatory effects of FSTL1 have also been described.E9Li K.C. Zhang F.X. Li C.L. Wang F. Yu M.Y. Zhong Y.Q. et al.Follistatin-like 1 suppresses sensory afferent transmission by activating Na+,K+-ATPase.Neuron. 2011; 69: 974-987Abstract Full Text Full Text PDF PubMed Scopus (73) Google Scholar Using a mouse model, we recently demonstrated that allergen challenge induced mouse lung macrophages to highly express FSTL1, which was associated with airway remodeling.3Miller M. Beppu A. Rosenthal P. Pham A. Das S. Karta M. et al.Fstl1 promotes asthmatic airway remodeling by inducing oncostatin M.J Immunol. 2015; 195: 3546-3556Crossref PubMed Scopus (39) Google Scholar Therefore, this study examined whether in humans, like in mice, allergen challenge could also induce expression of FSTL1 in the airway, and whether human bronchoalveolar lavage (BAL) macrophages like mouse macrophages expressed FSTL1 and were also activated by FSTL1 to express proremodeling mediators such as matrix metalloproteinase 9 (MMP9).4Broide D.H. Immunologic and inflammatory mechanisms that drive asthma progression to remodeling.J Allergy Clin Immunol. 2008; 121: 560-570Abstract Full Text Full Text PDF PubMed Scopus (197) Google Scholar To determine whether allergen challenge induced lung expression of FSTL1, stored BAL fluid samples from 12 subjects with mild allergic asthma (see Table E1 in this article's Online Repository at www.jacionline.org) were assayed for FSTL1 by ELISA (R&D, Minneapolis, Minn) in a protocol approved by the University of Wisconsin-Madison Health Sciences Institutional Review Board. In brief, segmental bronchoprovocation with allergen (SBP-Ag) and BAL (preallergen and postallergen) was performed (see this article's Methods sectionE3Le Luduec J.B. Condamine T. Louvet C. Thebault P. Heslan J.M. Heslan M. et al.An immunomodulatory role for follistatin-like 1 in heart allograft transplantation.Am J Transplant. 2008; 8: 2297-2306Crossref PubMed Scopus (45) Google Scholar, E4Miyamae T. Marinov A.D. Sowders D. Wilson D.C. Devlin J. Boudreau R. et al.Follistatin-like protein-1 is a novel proinflammatory molecule.J Immunol. 2006; 177: 4758-4762Crossref PubMed Scopus (99) Google Scholar) as previously described.5Gavala M.L. Kelly E.A. Esnault S. Kukreja S. Evans M.D. Bertics P.J. et al.Segmental allergen challenge enhances chitinase activity and levels of CCL18 in mild atopic asthma.Clin Exp Allergy. 2013; 43: 187-197Crossref PubMed Scopus (18) Google Scholar SBP-Ag in subjects with asthma induced a significant increase in levels of BAL FSTL1 protein (P < .03) (preallergen vs postallergen) (n = 12 subjects) (Fig 1, A). Nine additional subjects with asthma previously describedE10Gavala M.L. Kelly E.A. Esnault S. Kukreja S. Evans M.D. Bertics P.J. et al.Segmental allergen challenge enhances chitinase activity and levels of CCL18 in mild atopic asthma.Clin Exp Allergy. 2012; 43: 187-197Crossref Scopus (34) Google Scholar who had sufficient BAL cells were included to analyze FSTL1 mRNA expression before and after SBP-Ag. There was an increase in FSTL1 mRNA in BAL cells after SBP-Ag (assessed by real time quantitative PCR [RT-qPCR]) (see this article's Methods sectionE4Miyamae T. Marinov A.D. Sowders D. Wilson D.C. Devlin J. Boudreau R. et al.Follistatin-like protein-1 is a novel proinflammatory molecule.J Immunol. 2006; 177: 4758-4762Crossref PubMed Scopus (99) Google Scholar, E5Clutter S.D. Wilson D.C. Marinov A.D. Hirsch R. Follistatin-like protein 1 promotes arthritis by up-regulating IFN-gamma.J Immunol. 2009; 182: 234-239Crossref PubMed Scopus (80) Google Scholar, E6Dong Y. Geng Y. Li L. Li X. Yan X. Fang Y. et al.Blocking follistatin-like 1 attenuates bleomycin-induced pulmonary fibrosis in mice.J Exp Med. 2015; 212: 235-252Crossref PubMed Scopus (112) Google Scholar), which approximated statistical significance (P = .057) (preallergen vs postallergen) (n = 9 subjects) (Fig 1, B), and was positively associated with the percentage of BAL macrophages (see Table E2 in this article's Online Repository at www.jacionline.org). Levels of BAL cell FSTL1 mRNA correlated significantly with levels of BAL cell MMP9 mRNA (r = 0.67; P = .04) (Fig 1, F), but not with BAL MMP9 protein (not shown). The negative correlation between FSTL1 and eosinophils (Table E2) could indicate that FSTL1 may also have anti-inflammatory effects on eosinophils. In this regard, at least 2 studies of FSTL1 administration in mouse models of arthritis have demonstrated that FSTL1 has anti-inflammatory effects as demonstrated by reduced joint inflammation and reduced expression of IL-6 and prostaglandin E2.E11Kawabata D. Tanaka M. Fujii T. Umehara H. Fujita Y. Yoshifuji H. et al.Ameliorative effects of follistatin-related protein/TSC-36/FSTL1 on joint inflammation in a mouse model of arthritis.Arthritis Rheum. 2004; 50: 660-668Crossref PubMed Scopus (71) Google Scholar, E12Tanaka M. Ozaki S. Kawabata D. Kishimura M. Osakada F. Okubo M. et al.Potential preventive effects of follistatin-related protein/TSC-36 on joint destruction and antagonistic modulation of its autoantibodies in rheumatoid arthritis.Int Immunol. 2003; 15: 71-77Crossref PubMed Scopus (38) Google Scholar To determine whether human lung BAL macrophages expressed FSTL1, we used 2 approaches, immunostaining of postmortem human lungs of those with asthma to detect whether FSTL1 was expressed by alveolar macrophages, and investigation of whether postmortem human BAL macrophages expressed FSTL1. We immunostained postmortem lung sections (asthma and normal control) (n = 3/group) obtained from the National Disease Research Interchange (Philadelphia, Pa) with an anti–FSTL1 antibody (R&D) (see this article's Methods sectionE7Sundaram G.M. Common J.E. Gopal F.E. Srikanta S. Lakshman K. Lunny D.P. et al.‘See-saw’ expression of microRNA-198 and FSTL1 from a single transcript in wound healing.Nature. 2013; 495: 103-106Crossref PubMed Scopus (151) Google Scholar) (Fig 1, C-E). These studies demonstrated that FSTL1 was highly expressed in lung alveolar macrophages in asthma (Fig 1, E), but was not significantly expressed in control lung alveolar macrophages (Fig 1, C). The number of FSTL1+ cells was significantly higher in the airway of lungs of subjects with asthma compared with controls (P < .001) (n = 3) (Fig 1, E). To determine whether human BAL macrophages responded to FSTL1, BAL macrophages were obtained from human lungs by lavage postmortem (see this article's Methods sectionE8Chaly Y. Marinov A.D. Oxburgh L. Bushnell D.S. Hirsch R. FSTL1 promotes arthritis in mice by enhancing inflammatory cytokine/chemokine expression.Arthritis Rheum. 2012; 64: 1082-1088Crossref PubMed Scopus (58) Google Scholar) as previously described.6Graham J.G. MacDonald L.J. Hussain S.K. Sharma U.M. Kurten R.C. Voth D.E. Virulent Coxiella burnetii pathotypes productively infect primary human alveolar macrophages.Cell Microbiol. 2013; 15: 1012-1015Crossref PubMed Scopus (68) Google Scholar Incubation of BAL macrophages with FSTL1 (100 ng/mL) induced a significant increase in levels of macrophage FSTL1 mRNA as assessed by RT-qPCR as compared with macrophages cultured in media alone (P < .05) (Fig 2, A). TGF-β1, a known inducer of FSTL1, also significantly induced FSTL1 mRNA expression by BAL macrophages (P < .05) (Fig 2, A). These studies suggest that macrophage-derived FSTL1 can either through paracrine or autocrine mechanisms induce further FSTL1 expression by macrophages, similar to what we have noted in studies of mouse macrophages.3Miller M. Beppu A. Rosenthal P. Pham A. Das S. Karta M. et al.Fstl1 promotes asthmatic airway remodeling by inducing oncostatin M.J Immunol. 2015; 195: 3546-3556Crossref PubMed Scopus (39) Google Scholar In addition, FSTL1 induced BAL macrophages to express MMP9 mRNA as assessed by RT-qPCR (P < .05) (Fig 2, B), as well as MMP9 protein as quantitated by ELISA (R&D) (P < .05) (Fig 2, C). Previous studies have demonstrated that FSTL1 can activate Toll-like receptor 4 (TLR4)-dependent cytokine responses in cell types other than human BAL macrophages.E13Murakami K. Tanaka M. Usui T. Kawabata D. Shiomi A. Iguchi-Hashimoto M. et al.Follistatin-related protein/follistatin-like 1 evokes an innate immune response via CD14 and toll-like receptor 4.FEBS Lett. 2012; 586: 319-324Abstract Full Text Full Text PDF PubMed Scopus (54) Google Scholar Accordingly, we incubated BAL macrophages (n = 6 donors) with FSTL1 and an anti–TLR4 antibody and noted significantly reduced levels of FSTL1 mRNA (P < .02) (Fig 2, D) and MMP9 mRNA (P < .05) (Fig 2, E). Thus, blocking only TLR4 signaling inhibits FSTL1 activation of BAL macrophages in vitro. Further studies are needed to determine whether other TLR4-expressing cells in the lung that respond to FSTL1 do so through TLR4 and/or other known FSTL1 signaling pathways (ie, bone morphogenic protein, protein kinase B, adenosine monophosphate-activated protein kinase, Na/K-ATPase membrane potential).E13Murakami K. Tanaka M. Usui T. Kawabata D. Shiomi A. Iguchi-Hashimoto M. et al.Follistatin-related protein/follistatin-like 1 evokes an innate immune response via CD14 and toll-like receptor 4.FEBS Lett. 2012; 586: 319-324Abstract Full Text Full Text PDF PubMed Scopus (54) Google Scholar, E14Geng Y. Dong Y. Yu M. Zhang L. Yan X. Sun J. et al.Follistatin-like 1 (Fstl1) is a bone morphogenetic protein (BMP) 4 signaling antagonist in controlling mouse lung development.Proc Natl Acad Sci U S A. 2011; 108: 7058-7063Crossref PubMed Scopus (163) Google Scholar, E15Sylva M. Moorman A.F. van den Hoff M.J. Follistatin-like 1 in vertebrate development.Birth Defects Res. 2013; 99: 61-69Crossref PubMed Scopus (48) Google Scholar, E16Li K.C. Zhang F.X. Li C.L. Wang F. Yu M.Y. Zhong Y.Q. et al.Follistatin-like 1 suppresses sensory afferent transmission by activating Na+,K+-ATPase.Neuron. 2011; 69: 974-987Abstract Full Text Full Text PDF PubMed Scopus (42) Google Scholar In summary, we have made the novel observation that segmental allergen challenge increases levels of FSTL1 protein in the airway of subjects with asthma and that levels of human BAL cell FSTL1 mRNA correlate with levels of BAL cell MMP9 mRNA, a remodeling mediator we demonstrate is induced in macrophages by FSTL1 in vitro. In addition, we show that human lung airway macrophages express and respond to FSTL1, potentially through paracrine or autocrine pathways. This study also demonstrates that human lung alveolar macrophages can be induced to express FSTL1, which suggests a different cellular source of FSTL1 in asthma compared with other diseases (arthritis, autoimmune disease, coronary disease) where macrophages and myeloid cells are not a significant source of FSTL1.1Chaly Y. Hostager B. Smith S. Hirsch R. Follistatin-like protein 1 and its role in inflammation and inflammatory diseases.Immunol Res. 2014; 59: 266-272Crossref PubMed Scopus (71) Google Scholar, 2Sylva M. Moorman A.F. van den Hoff M.J. Follistatin-like 1 in vertebrate development.Birth Defects Res. 2013; 99: 61-69Crossref PubMed Scopus (17) Google Scholar FSTL1 in these diseases is generated in particular by nonhematopoietic cells such as cells of the mesenchymal lineage (fibroblasts, chondrocytes, osteocytes, adipocytes, cardiomyocytes).1Chaly Y. Hostager B. Smith S. Hirsch R. Follistatin-like protein 1 and its role in inflammation and inflammatory diseases.Immunol Res. 2014; 59: 266-272Crossref PubMed Scopus (71) Google Scholar The potential functional significance of allergen challenge inducing FSTL1 is suggested from our studies, demonstrating that in humans FSTL1 can induce BAL macrophages to express MMP9, a metalloproteinase associated with remodeling in asthma.7Kelly E.A. Busse W.W. Jarjour N.N. Increased matrix metalloproteinase-9 in the airway after allergen challenge.Am J Respir Crit Care Med. 2000; 162: 1157-1161Crossref PubMed Scopus (171) Google Scholar, 8Cataldo D.D. Tournoy K.G. Vermaelen K. Munaut C. Foidart J.M. Louis R. et al.Matrix metalloproteinase-9 deficiency impairs cellular infiltration and bronchial hyperresponsiveness during allergen-induced airway inflammation.Am J Pathol. 2002; 161: 491-498Abstract Full Text Full Text PDF PubMed Scopus (156) Google Scholar, 9Lim D.H. Cho J.Y. Miller M. McElwain K. McElwain S. Broide D.H. Reduced peribronchial fibrosis in allergen-challenged MMP-9-deficient mice.Am J Physiol Lung Cell Mol Physiol. 2006; 291: L265-L271Crossref PubMed Scopus (81) Google Scholar The present human study demonstrates that allergen challenge of subjects with asthma induces FSTL1 expression, and extends our observations in mice in which we have demonstrated that mouse Fstl1 promotes airway remodeling.3Miller M. Beppu A. Rosenthal P. Pham A. Das S. Karta M. et al.Fstl1 promotes asthmatic airway remodeling by inducing oncostatin M.J Immunol. 2015; 195: 3546-3556Crossref PubMed Scopus (39) Google Scholar Further study is needed to determine whether targeting FSTL1 would inhibit airway remodeling in humans with asthma. Sputum induction and processing was performed according to a standardized protocol.E17Miller M. Cho J.Y. Pham A. Friedman P.J. Ramsdell J. Broide D.H. Persistent airway inflammation and emphysema progression on CT scan in ex-smokers observed for 4 years.Chest. 2011; 139: 1380-1387Abstract Full Text Full Text PDF PubMed Scopus (36) Google Scholar In brief, a subject with asthma and a control subject were exposed for 20 minutes to an aerosol of 3% hypertonic saline solution using a NOUVAG Ultrasonic nebulizer (Nouvag USA Inc, Lake Hughes, Calif) and sputum was collected into 50-mL sterile ampoules. The volume of the induced sputum was determined, and an equal volume of dithiothreitol (0.1% in saline; Sigma Chemical Co, St Louis, Mo) was added. After homogenization, sputum samples were centrifuged at 2000g for 5 minutes to separate the supernatants from the cell pellet. The supernatants were then aspirated and frozen at −80°C in separate aliquots for subsequent analysis. A glass-slide–based proteomic array capable of detecting 508 proteins (Raybiotech, Norcross, Ga) was used to detect proteins in human sputum from a subject with asthma and a control subject according to the manufacturer instructions. To establish the dose of allergen to be administered by segmental challenge, a graded inhalation challenge was initially performed to determine the participant's provocative dose of allergen leading to a 20% fall in FEV1 (AgPD20) as described earlier.E10Gavala M.L. Kelly E.A. Esnault S. Kukreja S. Evans M.D. Bertics P.J. et al.Segmental allergen challenge enhances chitinase activity and levels of CCL18 in mild atopic asthma.Clin Exp Allergy. 2012; 43: 187-197Crossref Scopus (34) Google Scholar Allergens used were Dermatophagoides farinae (Der p 1, dust mite), Felis catus domesticus (Fel d 1, cat), or Ambrosia artemisiifolia (Amb a 1, ragweed), obtained from Greer Laboratories (Lenoir, NC). The segmental allergen challenge was performed at least 1 month after the inhalation allergen challenge. A baseline bronchoscopy with BAL was performed (4 × 40 mL aliquots of sterile 0.9% NaCl) in 2 bronchopulmonary segments (BAL preallergen). The preallergen BAL fluid was pooled for analysis. Segmental challenge at a total dose of 10% of the AgPD20 was performed in one bronchopulmonary segment and if well tolerated, a dose of 20% of the AgPD20 was administered in a second segment. Bronchoscopy with BAL was repeated 48 hours later and fluid from the 2 segments was pooled (BAL postallergen). BAL cells were recovered from the lavage fluid by centrifugation at 400g for 10 minutes at 4°C. BAL cells were washed twice with Hanks' balanced salt solution containing 2% newborn calf serum. For differential cell counts, blood smears and cytospin preparations of BAL cells were stained with the Giemsa-based Diff-Quik stain (Baxter Scientific Products, McGaw Park, Ill). Cells were lysed in RLT Buffer (Qiagen, Valencia, Calif) and stored at −80° C. BAL fluids were stored in 1 mL aliquots at −80°C until analyzed. Total RNA was extracted from BAL cells using the RNeasy Mini Kit (Qiagen). The reverse transcription reaction was performed using the Superscript III system (Invitrogen/Life Technologies, Grand Island, NY). mRNA expression was determined by quantitaive PCR using SYBR Green Master Mix (SABiosciences, Frederick, Md) for human FSTL1 (forward, ggttctctaaaggcagcaactacag; reverse, caggcgagaatcaccattatca) and TaqMan for human MMP9 (reference sequence NM_004994.2, ABI ID Hs00234579_m1). FSTL1-specific primers were designed using Primer Express 3.0 (Applied Biosystems, Carlsbad, Calif) and blasted against the human genome to determine specificity using http://www.ncbi.nlm.nih.gov/tools/primer-blast. The reference gene, β-glucuronidase (forward, caggacctgcgcacaagag; reverse, tcgcacagctggggtaag), was used to normalize the samples. Standard curves were drawn, and efficiencies were determined for each set of primers. Data are expressed as –ΔCT. Fold change after compared with before SBP-Ag was calculated using the comparative cycle threshold (ΔΔCT) method, with fold change = (2−ΔΔCt). Postmortem human lungs from subjects with asthma or controls without asthma were obtained from the National Disease Research Interchange (Philadelphia, Pa) in a protocol approved by the UCSD Human Research Protections program. Lung sections were immunostained with an anti–FSTL1 antibody (R&D) or species and isotype control antibody. The number of lung Fstl1+ airway cells was quantitated with image analysis (Image-Pro, Rockville, Md) in each lung and results expressed as FSTL1+ cells/mm2. Lung BAL was prepared from postmortem lungs at the Arkansa Children's Hospital Research Institute in an institutional review board–exempted protocol by cannulating the main intrapulmonary bronchus and inflation with 500 mL PBS and 1 mM glutathione using a peristaltic pump. Following collection, the BAL was centrifuged for 10 minutes at 1000g and the BAL cell pellet resuspended in 1/4 volume freezing buffer (10% dimethyl sulfoxide, 20% FBS, 70% Dulbecco modified Eagle medium:F12 medium), with aliquots frozen at 1°C/min and stored in liquid nitrogen. In these in vitro experiments, primary BAL macrophages from postmortem donor lungs were incubated with FSTL1 (100 ng/mL) or TGF-β1 (100 ng/mL) for 24 hours. Levels of BAL macrophage FSTL1 and MMP9 mRNA were quantitated by quantitative PCR, and of MMP9 protein in supernatants by ELISA (R&D). Human BAL macrophages (n = 6 donors) were incubated in vitro with either an anti–hTLR4-IgG-neutralizing antibody (10 μg/mL, InvivoGen, San Diego, Calif), or a species and isotype control mouse IgG antibody, for 1 hour before stimulation with FSTL1 (100 ng/mL) for 24 hours. Levels of FSTL1 mRNA and MMP9 mRNA were quantitated by RT-qPCR. Statistical analyses were performed using t tests and results reported as mean ± SEM unless otherwise indicated. P values of less than .05 were considered statistically significant.Table E1Characteristics of asthma study subjects in segmental allergen challenge studyCharacteristicValuen12Sex: female9Age (y)21.8 ± 2.8Baseline FEV1 (% of predicted)93.2 ± 11.4Methacholine PC20 (mg/mL)2.4 (1.3-2.7)Data are means ± SD or median (25th and 75th percentiles). All subjects were atopic (positive allergy skin prick test result), nonsmokers, and not on inhaled or oral corticosteroids. Asthma was defined using clinical criteria and confirmation with either a methacholine PC20 < 8 mg or reversibility to beta agonist (>10%).PC20, Provocative concentration of methacholine producing a 20% fall in FEV1. Open table in a new tab Table E2Correlation of BAL cell FSTL1 mRNA fold change (postallergen vs preallergen challenge) with BAL cellsBAL cellsFSTL1 mRNA(fold change, P value)Macrophages0.668, .049Eosinophils−0.660, .053Neutrophils0.473, .199Lymphocytes−0.152, .697Correlation of BAL cell FSTL1 mRNA fold change assessed by RT-PCR (postallergen vs preallergen challenge) with % BAL cells present after segmental allergen challenge. Pearson correlations and P values are indicated (n = 9). Open table in a new tab Data are means ± SD or median (25th and 75th percentiles). All subjects were atopic (positive allergy skin prick test result), nonsmokers, and not on inhaled or oral corticosteroids. Asthma was defined using clinical criteria and confirmation with either a methacholine PC20 < 8 mg or reversibility to beta agonist (>10%). PC20, Provocative concentration of methacholine producing a 20% fall in FEV1. Correlation of BAL cell FSTL1 mRNA fold change assessed by RT-PCR (postallergen vs preallergen challenge) with % BAL cells present after segmental allergen challenge. Pearson correlations and P values are indicated (n = 9).

RATIONALE:Chronic bronchitis is, by definition, a chronic condition, but the development and remission of this condition in cigarette smokers with or without chronic obstructive pulmonary disease (COPD) are poorly understood. Also, it is unclear how the persistence or new development of chronic bronchitis affects symptoms and outcomes.OBJECTIVES:To ascertain the relationship between smoking status and the presence or absence of chronic bronchitis and the subsequent effects on symptoms and outcomes.METHODS:We analyzed 1,775 current or ex-smokers with GOLD (Global Initiative for Chronic Obstructive Lung Disease) stage 0-IV COPD in phase 2 of the Genetic Epidemiology of COPD (COPDGene) Study, which included subjects after 5 years of follow-up from phase 1. We asked subjects at enrollment and at 5 years of follow-up about symptoms consistent with chronic bronchitis. We divided subjects into four groups: persistent chronic bronchitis- (negative at phase 1/negative at phase 2), resolved chronic bronchitis (positive/negative), new chronic bronchitis (negative/positive), and persistent chronic bronchitis+ (positive/positive). We analyzed respiratory symptoms, health-related quality of life, lung function, exacerbation frequency, and 6-minute walk distance.MEASUREMENTS AND MAIN RESULTS:Compared with the persistent chronic bronchitis- group, members of the persistent chronic bronchitis+ group were more likely to have continued smoking (53.4%). Subjects with new chronic bronchitis were more likely to have resumed (6.6%) or continued smoking (45.6%), whereas subjects with resolved chronic bronchitis were more likely to have quit smoking (23.5%). Compared with the persistent chronic bronchitis- group, the other groups had a shorter 6-minute walk distance, worse lung function, greater exacerbation frequency, and worse respiratory symptoms. Modified Medical Research Council dyspnea and St. George's Respiratory Questionnaire scores worsened between phase 1 and phase 2 in subjects with new chronic bronchitis but improved in the resolved chronic bronchitis group. On multinomial logistic regression, quitting smoking conferred an odds ratio (OR) of 4.289 (95% confidence interval [CI], 2.689-6.842) for resolved chronic bronchitis, whereas resuming smoking had an OR of 4.585 (95% CI, 2.008-10.471) for new chronic bronchitis. Persistent smoking had an OR of 2.621 (95% CI, 1.677-4.096) and 5.767 (95% CI, 3.702-8.983) for subjects with new chronic bronchitis and subjects with persistent chronic bronchitis, respectively.CONCLUSIONS:Persistent and newly developed chronic bronchitis are associated with continued or resumed smoking, greater respiratory symptoms, worse health-related quality of life, worse lung function, and greater exacerbation frequency. These findings stress the importance of repeatedly assessing chronic cough and sputum production in smokers to identify those at risk for poor outcomes.

Background: Implementation of patient preferences for use of electronic health records for research has been traditionally limited to identifiable data. Tiered e-consent for use of de-identified data has traditionally been deemed unnecessary or impractical for implementation in clinical settings. Methods: We developed a web-based tiered informed consent tool called informed consent for clinical data and bio-sample use for research (iCONCUR) that honors granular patient preferences for use of electronic health record data in research. We piloted this tool in 4 outpatient clinics of an academic medical center. Results: Of patients offered access to iCONCUR, 394 agreed to participate in this study, among whom 126 patients accessed the website to modify their records according to data category and data recipient. The majority consented to share most of their data and specimens with researchers. Willingness to share was greater among participants from an Human Immunodeficiency Virus (HIV) clinic than those from internal medicine clinics. The number of items declined was higher for for-profit institution recipients. Overall, participants were most willing to share demographics and body measurements and least willing to share family history and financial data. Participants indicated that having granular choices for data sharing was appropriate, and that they liked being informed about who was using their data for what purposes, as well as about outcomes of the research. Conclusion: This study suggests that a tiered electronic informed consent system is a workable solution that respects patient preferences, increases satisfaction, and does not significantly affect participation in research.

Asthma and chronic obstructive pulmonary disease (COPD) are common heterogeneous diseases with significant impact on morbidity, mortality, and health care costs. In most of the cases, the main features and pathophysiology differ substantially between both asthma and COPD, which allows differentiating both entities and providing appropriate treatment. The recognition of a subgroup of patients who present clinically with features of both conditions, asthma chronic obstructive pulmonary disease overlap syndrome, has reignited the question of whether asthma and COPD are different manifestations of the same disease or unique processes, the so-called Dutch hypothesis versus British hypothesis controversy. There is enough heterogeneity in the clinical and mechanistic profiles of these 3 diseases, and subsets of these 3 diseases, to suggest that a new approach relying on the concept of endotypes of obstructive airways disease may be more useful. This characterization has provided the basis for opening new areas of research that may eventually lead to the development of new targeted drugs. This review focuses on the current knowledge of asthma, COPD, and asthma chronic obstructive pulmonary disease overlap syndrome phenotypes with emphasis on mechanisms of disease and how these may define endotypes, providing a more rational approach to research and clinical care. (C) 2015 American Academy of Allergy, Asthma & Immunology.

Recent studies suggest that males with chronic obstructive pulmonary disease (COPD) have more emphysema than females. It is not known if these differences persist across degrees of COPD severity. Our aim was to identify sex-specific differences in quantitative emphysema within COPD subgroups based on COPD severity.We included non-Hispanic white and African-American subjects from the COPDGene study with at least 10 pack-years of smoking and COPD Global Initiative for Chronic Obstructive Lung Disease (GOLD) spirometry grade II or greater. We examined sex-specific differences in log-transformed emphysema (log per cent low-attenuation area (%LAA)) by GOLD spirometry grade among subjects with early-onset COPD (<55 years old) and advanced emphysema (>25% emphysema).Compared with females, males had higher log %LAA: overall (1.97±1.4versus1.69±1.6, β=0.32 (0.04), p=1.34×10−14), and among non-Hispanic white (p=8.37×10−14) and African-American subjects (p=0.002). Females with early-onset COPD, severe emphysema and GOLD grade IV COPD had similar emphysema as males, but markedly fewer pack-years smoking (early-onset, p=0.01; severe emphysema and GOLD grade IV, p<0.001).This study identifies subsets of female smokers with COPD who are particularly susceptible to parenchymal destruction.

RATIONALEWhen obstructive sleep apnea (OSA) and chronic obstructive pulmonary disease (COPD) coexist in the so-called "overlap" syndrome, a high risk for mortality and morbidity has been reported. There is controversy about the prevalence of OSA in people affected by COPD.OBJECTIVESThe purpose of this study was to investigate objective meaures of sleep-disordered breathing in patients with moderate to severe COPD to test the hypothesis that COPD is associated with an increased prevalence of OSA.METHODSFifty-four patients (54% men) with moderate to severe COPD were enrolled prospectively (mean ± SD, FEV1 = 42.8 ± 19.8% predicted, and FEV1/FVC = 42.3 ± 13.1). Twenty patients (37%) were on supplemental oxygen at baseline. Exercise tolerance; questionnaires related to symptoms, sleep, and quality of life; and home polysomnography were obtained.MEASUREMENTS AND MAIN RESULTSForty-four patients had full polysomnography suitable for analysis. OSA (apnea-hypopnea index > 5/h) was present in 29 subjects (65.9%). Sleep efficiency was poor in 45% of subjects.CONCLUSIONSOSA is highly prevalent in patients with moderate to severe COPD referred to pulmonary rehabilitation. Sleep quality is also poor among this selected group. These patients have greater-than-expected sleep-disordered breathing, which could be an important contributory factor to morbidity and mortality. Pulmonary rehabilitation programs should consider including a sleep assessment in patients with moderate to severe COPD and interventions when indicated to help reduce the impact of OSA in COPD.

Persons with hyperreactive airways differ quantitatively from normal persons in their response to bronchial provocation testing with methacholine chloride (Mch). Methacholine chloride has strong hygroscopic properties that necessitate careful dessication, preparation, and handling if accurate results are to be achieved. The rate of hydration of Mch was determined by exposing the drug to various levels of relative humidity. The rate of water uptake was directly related to the availability of water in the atmosphere. At 49% relative humidity, a 0.125%/min gain in weight was noted, which increased to 0.489%/min at 80% relative humidity. Adequate dessication time and technique were determined by noting the time required to return the drug from a hydrated to a dry state. With proper technique, dessication was virtually complete by 4 to 6 h, and 20 to 24 h assured a return to the dry state. From these data, guidelines for preparation and handling of Mch test solutions can be formulated.

Importance Comorbidities are common in COPD, but quantifying their burden is difficult. Currently there is a COPD-specific comorbidity index to predict mortality and another to predict general quality of life. We sought to develop and validate a COPD-specific comorbidity score that reflects comorbidity burden on patient-centered outcomes. Materials and Methods Using the COPDGene study (GOLD II-IV COPD), we developed comorbidity scores to describe patient-centered outcomes employing three techniques: 1) simple count, 2) weighted score, and 3) weighted score based upon statistical selection procedure. We tested associations, area under the Curve (AUC) and calibration statistics to validate scores internally with outcomes of respiratory disease-specific quality of life (St. George's Respiratory Questionnaire, SGRQ), six minute walk distance (6MWD), modified Medical Research Council (mMRC) dyspnea score and exacerbation risk, ultimately choosing one score for external validation in SPIROMICS. Results Associations between comorbidities and all outcomes were comparable across the three scores. All scores added predictive ability to models including age, gender, race, current smoking status, pack-years smoked and FEV1 (p<0.001 for all comparisons). Area under the curve (AUC) was similar between all three scores across outcomes: SGRQ (range 0·7624–0·7676), MMRC (0·7590–0·7644), 6MWD (0·7531–0·7560) and exacerbation risk (0·6831–0·6919). Because of similar performance, the comorbidity count was used for external validation. In the SPIROMICS cohort, the comorbidity count performed well to predict SGRQ (AUC 0·7891), MMRC (AUC 0·7611), 6MWD (AUC 0·7086), and exacerbation risk (AUC 0·7341). Conclusions Quantifying comorbidity provides a more thorough understanding of the risk for patient-centered outcomes in COPD. A comorbidity count performs well to quantify comorbidity in a diverse population with COPD.

Individuals with chronic obstructive pulmonary disease (COPD) and asthma are an important but poorly characterised group. The genetic determinants of COPD and asthma overlap have not been studied. The aim of this study was to identify clinical features and genetic risk factors for COPD and asthma overlap.Subjects were current or former smoking non-Hispanic whites or African–Americans with COPD. Overlap subjects reported a history of physician-diagnosed asthma before the age of 40 years. We compared clinical and radiographic features between COPD and overlap subjects. We performed genome-wide association studies (GWAS) in the non-Hispanic whites and African–American populations, and combined these results in a meta-analysis. More females and African–Americans reported a history of asthma. Overlap subjects had more severe and more frequent respiratory exacerbations, less emphysema and greater airway wall thickness compared to subjects with COPD alone.The non-Hispanic white GWAS identified single nucleotide polymorphisms in the genesCSMD1(rs11779254, p=1.57×10−6) andSOX5(rs59569785, p=1.61×10−6) and the meta-analysis identified single nucleotide polymorphisms in the geneGPR65(rs6574978, p=1.18×10−7) associated with COPD and asthma overlap.Overlap subjects have more exacerbations, less emphysema and more airway disease for any degree of lung function impairment compared to COPD alone. We identified novel genetic variants associated with this syndrome. COPD and asthma overlap is an important syndrome and may require distinct clinical management.

BACKGROUND: The risk factors for acute episodes of respiratory disease in current and former smokers who do not have COPD are unknown.METHODS: Eight thousand two hundred forty-six non-Hispanic white and black current and former smokers in the Genetic Epidemiology of COPD (COPDGene) cohort had longitudinal follow-up (LFU) every 6 months to determine acute respiratory episodes requiring antibiotics or systemic corticosteroids, an ED visit, or hospitalization. Negative binomial regression was used to determine the factors associated with acute respiratory episodes. A Cox proportional hazards model was used to determine adjusted hazard ratios (HRs) for time to first episode and an acute episode of respiratory disease risk score.RESULTS: At enrollment, 4,442 subjects did not have COPD, 658 had mild COPD, and 3,146 had moderate or worse COPD. Nine thousand three hundred three acute episodes of respiratory disease and 2,707 hospitalizations were reported in LFU (3,044 acute episodes of respiratory disease and 827 hospitalizations in those without COPD). Major predictors included acute episodes of respiratory disease in year prior to enrollment (HR, 1.20; 95% CI, 1.15-1.24 per exacerbation), airflow obstruction (HR, 0.94; 95% CI, 0.91-0.96 per 10% change in % predicted FEV1), and poor health-related quality of life (HR, 1.07; 95% CI, 1.06-1.08 for each 4-unit increase in St. George's Respiratory Questionnaire score). Risks were similar for those with and without COPD.CONCLUSIONS: Although acute episode of respiratory disease rates are higher in subjects with COPD, risk factors are similar, and at a population level, there are more episodes in smokers without COPD.

BACKGROUND COPD patients have a great burden of comorbidity. However, it is not well established whether this is due to shared risk factors such as smoking, if they impact patients exercise capacity and quality of life, or whether there are racial disparities in their impact on COPD. METHODS We analyzed data from 10,192 current and ex-smokers with (cases) and without COPD (controls) from the COPDGene® cohort to establish risk for COPD comorbidities adjusted for pertinent covariates. In adjusted models, we examined comorbidities prevalence and impact in African-Americans (AA) and Non-Hispanic Whites (NHW). RESULTS Comorbidities are more common in COPD compared to those with normal spirometry (controls), and the risk persists after adjustments for covariates including pack-years smoked. After adjustment for confounders, eight conditions were independently associated with worse exercise capacity, quality of life and dyspnea. There were racial disparities in the impact of comorbidities on exercise capacity, dyspnea and quality of life, presence of osteoarthritis and gastroesophageal reflux disease having a greater negative impact on all three outcomes in AAs than NHWs (p<0.05 for all interaction terms). CONCLUSIONS Individuals with COPD have a higher risk for comorbidities than controls, an important finding shown for the first time comprehensively after accounting for confounders. Individual comorbidities are associated with worse exercise capacity, quality of life, and dyspnea, in African-Americans compared to non-Hispanic Whites.

Chronic obstructive pulmonary disease (COPD) has been classically divided into blue bloaters and pink puffers. The utility of these clinical subtypes is unclear. However, the broader distinction between airway-predominant and emphysema-predominant COPD may be clinically relevant. The objective was to define clinical features of emphysema-predominant and non-emphysematous COPD patients.

RATIONALE AND OBJECTIVES Asthma is associated with chronic airflow obstruction. Our goal was to assess the association of computed tomographic measures of airway wall volume and lumen volume with the FEV1 and chronic airflow obstruction in smokers with childhood-onset asthma. METHODS We analyzed clinical, lung function, and volumetric computed tomographic airway volume data from 7,266 smokers, including 590 with childhood-onset asthma. Small wall volume and small lumen volume of segmental airways were defined as measures 1 SD below the mean. We assessed the association between small wall volume, small lumen volume, FEV1, and chronic airflow obstruction (post-bronchodilator FEV1/FVC ratio < 0.7) using linear and logistic models. MEASUREMENTS AND MAIN RESULTS Compared with subjects without childhood-onset asthma, those with childhood-onset asthma had smaller wall volume and lumen volume (P < 0.0001) of segmental airways. Among subjects with childhood-onset asthma, those with the smallest wall volume and lumen volume had the lowest FEV1 and greatest odds of chronic airflow obstruction. A similar tendency was seen in those without childhood-onset asthma. When comparing these two groups, both small wall volume and small lumen volume were more strongly associated with FEV1 and chronic airflow obstruction among subjects with childhood-asthma in multivariate models. CONCLUSION In smokers with childhood-onset asthma, smaller airways are associated with reduced lung function and chronic airflow obstruction. Clinical trial registered with www.clinicaltrials.gov (NCT00608764).

Anticholinergic alkaloids have been used for thousands of years for the relief of bronchoconstriction and other respiratory symptoms, and their use in the treatment of chronic obstructive pulmonary disease is well established. Acetylcholine, acting through muscarinic receptor (M) receptor, modulates multiple physiologic functions pertinent to asthma including airway muscle tone, mucus gland secretion, and various parameters of inflammation and remodeling. In addition, activation of M receptors may inhibit beta2 adrenoreceptor. These observations offer the rationale for the use of M receptors antagonists in the treatment of asthma. Short-acting antimuscarinic agents may be effective alone or in combination with short-acting beta agonists for the relief of acute symptoms. Long-acting antimuscarinic agents have emerged as potentially useful in the long-term treatment of difficult-to-control asthma. This review will analyze the mechanisms of action and therapeutic role of antimuscarinic agents on asthma including current guidelines regarding antimuscarinic drugs, recent studies in asthma, special populations to consider, and possible predictors of response.

We examined the relationship between serum 25-hydroxyvitamin D (25[OH]D) and all-cause mortality. We searched biomedical databases for articles that assessed 2 or more categories of 25(OH)D from January 1, 1966, to January 15, 2013. We identified 32 studies and pooled the data. The hazard ratio for all-cause mortality comparing the lowest (0–9 nanograms per milliliter [ng/mL]) to the highest (> 30 ng/mL) category of 25(OH)D was 1.9 (95% confidence interval = 1.6, 2.2; P < .001). Serum 25(OH)D concentrations less than or equal to 30 ng/mL were associated with higher all-cause mortality than concentrations greater than 30 ng/mL (P < .01). Our findings agree with a National Academy of Sciences report, except the cutoff point for all-cause mortality reduction in this analysis was greater than 30 ng/mL rather than greater than 20 ng/mL.