NR5A1 or steroidogenic factor 1 (SF1) is an autosomal gene, which encodes a protein that is a member of nuclear receptor family. NR5A1 regulates the transcription of numerous genes that are expressed in hypothalamic-pituitary-gonadal axis and adrenal cortex which in turn, coordinate the gonadal development, steroidogenesis and sex differentiation. Several mutations in NR5A1 have been reported to cause gonadal dysgenesis with adrenal insufficiency in individuals with 46,XY karyotype. However, studies in the past few years have shown that NR5A1 mutations can also contribute to primary ovarian insufficiency and impaired spermatogenesis. As there is no genetic study on NR5A1 in Indian infertile men, we have sequenced the entire coding region (exons 2-7) of NR5A1 in 502 infertile men of which, 414 were non-obstructive azoospermic and 88 severe oligozoospermic, along with 427 ethnically matched fertile controls. Interestingly, none of the mutations reported to be associated with male infertility were found in our study, except one polymorphism, rs1110061. However, it was not significantly different between infertile and fertile groups (p = .76). In addition, we have identified six intronic variants; but none of them was significantly associated with male infertility.

Calcium/calmodulin-dependent protein kinase IV (CAMK4) is a multifunctional serine/threonine protein kinase, which plays an important role in the spermatogenesis by phosphorylating protamines. It has been shown to be involved in the regulation of human sperm motility. Moreover, the Camk4 knockout mice were infertile because of severely reduced sperm count and morphological abnormalities. As no study is available on the association of this gene with male infertility, we analysed all the exons of CAMK4 gene in ethnically matched 283 infertile and 268 fertile Indian men. We identified twenty nucleotide substitutions, of which twelve were novel. Of these novel variants, eight were exclusively detected in infertile men. Moreover, two infertile men-specific mutations were non-synonymous replacing amino acids at the highly conserved region. In silico analysis predicted both of these mutations as 'deleterious'. In addition to nucleotide substitutions, we identified five novel insertion-deletion mutations; of these, g.150264_66delGCG was exclusively found in two oligoasthenoteratozoospermic men. In silico analysis of infertile men exclusive mutations predicted that they can alter/diminish the potential binding sites of splicing factors, which may affect the mRNA splicing and protein translation. Our study suggests that the mutations in CAMK4 may lead to abnormal semen parameters.

Recent studies suggest that estrogens play an important role in male fertility. Estrogen signaling is mediated by Estrogen Receptors (ERalpha and ERbeta). Association of ERbeta with male infertility has not been analyzed to date except for genotyping of known polymorphisms in two different studies, which yielded controversial interpretation. Hence, we performed sequencing of all the exons and untranslated regions of ERbeta gene in 300 infertile and 255 fertile control Indian men. We identified eight novel mutations and four known single nucleotide polymorphisms (SNPs). Of the eight novel mutations, four were non-synonymous, of which one was detected only in infertile men, whereas the other three mutations were detected only in fertile men. Using different bioinformatics tools, we predicted that non-synonymous mutations were benign and they neither altered the structure nor the function of the protein. Among synonymous novel mutations, one was detected in both fertile and infertile men, two were exclusive to infertile men and one was exclusive to fertile men. None of the known SNPs or novel mutations showed statistically significant difference between infertile and fertile men. Moreover, infertile men having ERbeta mutations had normal reproductive tract and serum hormone levels. Our results suggest that the SNPs and mutations in ERbeta gene are not a common cause of spermatogenesis failure in Indian men, although mutations specifically found in infertile men can affect transcription, translation or have synergic effect with other variants in causing infertility.

Apolipoprotein B (APOB) plays a key role in lipoprotein metabolism and plasma lipid transport. It has been shown that about two-thirds of male mice heterozygous for ApoB were infertile. Moreover, a 3-codon deletion polymorphism (rs11279109) in the signal peptide region of the APOB gene has been shown to be a risk factor for infertility in Slovenian men, but its association with infertility in Indian men has not been evaluated to date. Hence, in the present study, we have genotyped this polymorphism in 545 Indian men, including 294 infertile and 251 fertile men. Our results show that the distribution of this deletion polymorphism was consistent with the Hardy-Weinberg equilibrium in both infertile and fertile men. No statistically significant difference was observed in the distribution of the APOB signal peptide deletion polymorphism between infertile and fertile men (chi(2) = 0.156, P = .925 for genotypes; chi(2) = 0.015, P = .903 for alleles). Moreover, no significant difference was observed when infertile and fertile men were categorized on the basis of presence (D/D and D/W genotypes) or absence (W/W genotypes) of deletion (odds ratio, 0.955; 95% confidence interval, 0.644-01.418; P = .820). Our study concludes that the APOB gene deletion polymorphism is not a risk factor for the development of infertility in Indian men.

The UBE2B gene encodes ubiquitin-conjugating enzyme, which is involved in DNA repair. Ube2b knockout mice were found to be infertile because of structural abnormality of sperm. However, there is no genetic study on the role of the UBE2B gene in human fertility; therefore, the present investigation was designed to study genetic variations in the UBE2B gene and its role in human male infertility. Sequence analyses of the UBE2B gene in 530 infertile (350 azoospermic, 105 oligoasthenoteratozoospermic, and 75 oligoasthenozoospermic) and 300 fertile control men revealed the presence of 5 substitution single-nucleotide polymorphisms (SNPs) in 221 individuals (199 infertile [37.5%] and 22 fertile [7.3%] men). Of these, 2 (g.5197:T>G; g.9157:A>G) of the 5 substitutions were novel and observed only in infertile men. Distribution of haplotypes TA, TG, GA, and GG are not uniform between the patient and the control group of this study. Interestingly, our study suggests that the haplotype TG conferred significantly increased risk for male infertility (odds ratio = 5.07, 95% CI = 1.29-23.29, p = .007). In silico analysis of SNPs that were specific to infertile men predicted that these SNPs lead to defective splicing by destroying or creating the potential binding site of splicing factors or causing alteration in predicted regulatory sequences. In the light of the above, our study suggests that the UBE2B gene is associated with male infertility in Indian men, hence, providing evidence for additional genetic factors for male infertility.

Sir, Previously we had reported mutational analysis of the mature peptide region of inhibin genes (INHA, INHBA and INHBB) in Indian women with ovarian failure (Dixit et al., 2004). This article has reported a significant association of the c.769G>A (p.Ala257Thr) missense variant in INHA gene (inhibin alpha) in Indian women with ovarian failure. Our article demonstrated the presence of this variant in 11.2% cases of premature ovarian failure (POF) and 9.1% cases of primary amenorrhoea (PA) with their complete absence in controls. This published article described a case–control study based on the 80 cases of POF, 33 cases of PA and 100 controls. The potential importance of this variant encouraged us to further analyse the germline status of the complete coding region of INHA gene with an increased population size. The other two inhibin genes INHBA and INHBB were not found to be associated with ovarian failure and hence were not considered for further analysis. This letter reports an enhanced mutational analysis of the complete coding region of INHA gene in 133 cases of POF, 63 cases of PA and 200 controls including the previously reported individuals. Our published article described the sequence analysis of only second half of the second exon, which codes for the mature peptide region. This letter additionally introduces the sequence analysis of the first exon and first half of the second exon covering the signal peptide as well as the proregion. The first exon was amplified using INHAEX1F (5′GTCGCTTGAGGCGAAATCC3′) and INHAEX1R (5′GTCTCCCAGCGCATACTTC3′) primers. The first half of the second exon was amplified using INHAEX2AF (5′CCGGAGGGCGTGGAGCAGAGT3′) and INHAEX2AR (5′GGCGCAGAGCAGAGGGAGACCAA3′) primers. The second half of the second exon (mature peptide region) was amplified as mentioned earlier (Shelling et al., 2000). The updated prevalence of c.769G>A variant is 10.5% of cases of POF (14 out of 133, Fisher’s exact test, P = 0.000017), 10% of cases of PA (six out of 60, Fisher’s exact test, P = 0.0007), with its presence in one out of 200 controls. All the mutant individuals were heterozygous except one homozygous, which was identified in our published article. The earlier reported SNP c.1–124A>G (rs11893842) was revealed with the genotypic distribution in POF cases (AA = 66, AG = 53 and GG = 14), PA cases (AA = 32, AG = 22 and GG = 6) and controls (AA = 110, AG = 74 and GG = 16) (Harris et al., 2006). This SNP represented almost similar genotypic distribution among the patient and control population. The earlier reported variant c.1–16C>T (mentioned as 129C>T by Montgomery et al., 2000; Marozzi et al., 2002) was present in 16 cases (12%) of POF, seven cases (11.7%) of PA and 26 (13%) controls. The two earlier reports illustrated a significant under-representation of the T allele in cases with ovarian failure (Marozzi et al., 2002; Harris et al., 2006). The present data do not find a significant difference in the prevalence of T allele among the patients and controls. This allelic difference may be due to the population diversity. A novel silent variant c.327C>T was revealed in four cases (6.67%) of PA, three cases (2.25%) of POF and 10 (5%) controls. One control was homozygous for this variant, and all the remaining individuals were heterozygous. The presence of c.531C>T variant was corroborated to have a complete linkage with the c.1–16C>T variant similarly as reported by Montgomery et al. (2000). Interestingly, four novel missense variants were revealed in the proregion. Three missense variants c.275G>A (p.Ser92Asn), c.525C>G (p.His175Gln) and c.545C>A (p.Ala182Asp) were exclusively associated with the patients, and one missense variant c.487G>A (p.Val163Met) was present in a control. The c.275G>A (p.Ser92Asn) missense variant was heterozygous with its presence in a POF patient. Upon aligning the available protein sequences against human serine demonstrated the similar residue (in rhesus macaque, dog and cow) or arginine residue (in horse and pig) or threonine residue (rat and mouse) but never asparagine. This patient also had the homozygous truncation variant c.631C>T (p.Glu211X) in the BMP15 gene as reported in our recently published article (Dixit et al., 2006). This patient had facial paralysis with 85.0 IU/l FSH levels and 37.0 IU/l LH levels. She had only withdrawal of bleeding upon medication. The ovaries were not visualized in the patient. She underwent two IVF cycles but failed both times. The c.525C>G (p.His175Gln) missense variant was heterozygous with its presence in a POF patient. The patient attained menopause at 30 years and was diagnosed with high FSH and LH levels as 78 and 47 IU/l, respectively. The proband’s mother was also heterozygous for this variant and attained menopause at 36 years with high gonadotrophin levels. The patient’s father and her sister were genotypically normal and had no history of infertility. The alignment of available protein sequences against histidine revealed that most of the other vertebrate sequences were containing arginine but never glutamine. The c.545C>A (p.Ala182Asp) missense variant was homozygous with its presence in a PA patient. She had FSH and LH levels as 9 and 7 IU/l, respectively. She never attained menarche and presented under-developed secondary sexual characters. The protein alignment depicted the highly conserved nature of wild-type alanine among the various vertebrates. Thus, the substitution of alanine may possibly lead to functional defects. One missense variant c.487G>A (p.Val163Met) was revealed in a control. This variant was

BACKGROUND:Elevation of FSH is frequently a consequence of impaired ovarian follicle growth. Down-regulation of the FSH levels by inhibins is mediated through its receptor betaglycan in the gonadotrophs. Understanding of germline status of the betaglycan gene (TGFBR3) is essential for ovarian failure pathophysiology.METHODS:Sequence analysis was performed for the coding region of TGFBR3 gene in a cohort of 196 ovarian failure cases that include 133 premature ovarian failure (POF) cases, 63 primary amenorrhoea (PA) cases compared with 200 controls.RESULTS:Forty-six variants including six novel exonic variants and 16 novel intronic variants were revealed. Two variants were missense: (i) p.Iso184Val in a control and (ii) p.Pro775Ser in a POF case. Genotypic distribution of three variants (c.382-81C>T, c.382-77T>C and c.1200G>A) was significantly different in the patients as compared with the controls. Five variants c.382-81C>T, c.382-77T>C, c.566-216G>A, c.1200G>A and c.2022T>C were chosen for haplotyping. The CCAAT haplotype was significantly higher in the patient population as compared with the controls (P = 0.00007).CONCLUSION:This study establishes the first mutational report of the TGFBR3 gene in correlation with ovarian failure. Significant diversity of genotype distribution and haplotype analysis suggested susceptibility of the TGFBR3 gene for ovarian failure aetiology.

Premature ovarian failure (POF) may be idiopathic or may be associated with genetic or autoimmune disorders. It is well known that chromosomal defects can impair ovarian development and its function. It is estimated that X‐chromosome abnormalities occur in 10–25% of women with abnormal ovarian function. Of these, the common chromosome defects reported are either true Turner's karyotype or its variants. We describe a novel X‐chromosome aberration in a woman with primary amenorrhea. Cytogenetic and florescence in situ hybridization analysis revealed a short‐arm deletion of X‐chromosome as a Turner's variant [mos,45,XO/46,Xdel(X)(p11.1–p22.3)]. This interesting and rare case with unique X‐chromosome defect reveals an additional mechanism for the cause of POF.

BACKGROUND:Vascular endothelial growth factor (VEGF), a major mediator of angiogenesis and vascular permeability, is known to play a key role in the pathophysiology of endometriosis.METHODS AND RESULTS:The single nucleotide polymorphisms, -460C>T and +405G>C, in the 5'-untranslated region of the VEGF gene were tested for association in a case-control study of 215 affected women and 210 women with no evidence of disease. All the women were of South Indian origin and ascertained from the same infertility clinic. The genotype and allele frequencies of the -460C>T polymorphism did not differ significantly between cases and controls. In contrast, the genotype (P = 0.002) and allele (P = 0.001) frequencies of the +405G>C polymorphism showed a significant difference between cases and controls. The +405 GG genotype was found more often in patients with an endometrioma >3 cm compared to controls. The frequency of the -460T/+405C haplotype (P = 0.016) was significantly lower in affected women compared to controls.CONCLUSIONS:The -460T/+405C haplotype in the VEGF gene, which is associated with lower promoter activity, was significantly less common in women with endometriosis than in controls. These data suggest that the +405G allele may influence the likelihood of a woman developing the disease.

ObjectiveMicrodeletion syndromes are a heterogeneous group of disorders caused by deletion of specific regions of chromosomal DNA that are not visible using standard chromosome analysis. The natural transmission of these chromosome deletions is rare events occasionally reported in the literature. We present an interesting finding where inheritance of p arm deletion of chromosome 13 for the past four generations was noted in a family with four males and two females. This defect is predominant in males of the family, with abnormal fertility status and low intellectual abilities, whereas females with the defect are absolutely normal. All the males with the defect suffered from primary infertility with oligoasthenoteratozoospermia.DesignThe present study is entirely a familial case report.Materials and methodsSix affected individuals from a family were analyzed using cytogenetic banding techniques, Florescence In Situ Hybridization (FISH), NCBI sequence blast analysis and Quantitative PCR.ResultsThe deletion was initially detected with G-banding and later confirmed using FISH. This reveals that genes on p arm of chromosome 13 have association with the mental status and fertility aspects. It is important to define the pathogenetic significance of deletion of chromosome 13p in association with intellectual rates and infertility. Molecular investigations using STS markers and genes showed normal Y chromosome. The sequence BLAST analysis of the breakpoints in deletion region of chromosome 13p in the affected individuals showed 85% homology with the Yq region.ConclusionsIn addition to the SRY, DAZ, DFFRY and other genes on the Y chromosome, many autosomal genes are also involved in testicular development and spermatogenesis. Hypothetically, the altered fertility rate observed among the males in the four generations follow the position-effect variegation (PEV) phenomenon. Molecular characterization is currently underway to annotate the underlying sequences of the 13p region with Yq region. Further, studies are in progress to narrow down and map the candidate gene(s) that are present in the 13p deletion breakpoint. This will allow understanding the possible mechanisms by which the deletion might affect meiosis in spermatogenesis and lead to infertility. This familial case report would further help to find the novel relationship between autosomal aberrations and testicular dysgenesis or spermatogenesis arrest. Also, map the corresponding regions on other autosomes in regard to the recorded aberrations accompanying these disturbances. ObjectiveMicrodeletion syndromes are a heterogeneous group of disorders caused by deletion of specific regions of chromosomal DNA that are not visible using standard chromosome analysis. The natural transmission of these chromosome deletions is rare events occasionally reported in the literature. We present an interesting finding where inheritance of p arm deletion of chromosome 13 for the past four generations was noted in a family with four males and two females. This defect is predominant in males of the family, with abnormal fertility status and low intellectual abilities, whereas females with the defect are absolutely normal. All the males with the defect suffered from primary infertility with oligoasthenoteratozoospermia. Microdeletion syndromes are a heterogeneous group of disorders caused by deletion of specific regions of chromosomal DNA that are not visible using standard chromosome analysis. The natural transmission of these chromosome deletions is rare events occasionally reported in the literature. We present an interesting finding where inheritance of p arm deletion of chromosome 13 for the past four generations was noted in a family with four males and two females. This defect is predominant in males of the family, with abnormal fertility status and low intellectual abilities, whereas females with the defect are absolutely normal. All the males with the defect suffered from primary infertility with oligoasthenoteratozoospermia. DesignThe present study is entirely a familial case report. The present study is entirely a familial case report. Materials and methodsSix affected individuals from a family were analyzed using cytogenetic banding techniques, Florescence In Situ Hybridization (FISH), NCBI sequence blast analysis and Quantitative PCR. Six affected individuals from a family were analyzed using cytogenetic banding techniques, Florescence In Situ Hybridization (FISH), NCBI sequence blast analysis and Quantitative PCR. ResultsThe deletion was initially detected with G-banding and later confirmed using FISH. This reveals that genes on p arm of chromosome 13 have association with the mental status and fertility aspects. It is important to define the pathogenetic significance of deletion of chromosome 13p in association with intellectual rates and infertility. Molecular investigations using STS markers and genes showed normal Y chromosome. The sequence BLAST analysis of the breakpoints in deletion region of chromosome 13p in the affected individuals showed 85% homology with the Yq region. The deletion was initially detected with G-banding and later confirmed using FISH. This reveals that genes on p arm of chromosome 13 have association with the mental status and fertility aspects. It is important to define the pathogenetic significance of deletion of chromosome 13p in association with intellectual rates and infertility. Molecular investigations using STS markers and genes showed normal Y chromosome. The sequence BLAST analysis of the breakpoints in deletion region of chromosome 13p in the affected individuals showed 85% homology with the Yq region. ConclusionsIn addition to the SRY, DAZ, DFFRY and other genes on the Y chromosome, many autosomal genes are also involved in testicular development and spermatogenesis. Hypothetically, the altered fertility rate observed among the males in the four generations follow the position-effect variegation (PEV) phenomenon. Molecular characterization is currently underway to annotate the underlying sequences of the 13p region with Yq region. Further, studies are in progress to narrow down and map the candidate gene(s) that are present in the 13p deletion breakpoint. This will allow understanding the possible mechanisms by which the deletion might affect meiosis in spermatogenesis and lead to infertility. This familial case report would further help to find the novel relationship between autosomal aberrations and testicular dysgenesis or spermatogenesis arrest. Also, map the corresponding regions on other autosomes in regard to the recorded aberrations accompanying these disturbances. In addition to the SRY, DAZ, DFFRY and other genes on the Y chromosome, many autosomal genes are also involved in testicular development and spermatogenesis. Hypothetically, the altered fertility rate observed among the males in the four generations follow the position-effect variegation (PEV) phenomenon. Molecular characterization is currently underway to annotate the underlying sequences of the 13p region with Yq region. Further, studies are in progress to narrow down and map the candidate gene(s) that are present in the 13p deletion breakpoint. This will allow understanding the possible mechanisms by which the deletion might affect meiosis in spermatogenesis and lead to infertility. This familial case report would further help to find the novel relationship between autosomal aberrations and testicular dysgenesis or spermatogenesis arrest. Also, map the corresponding regions on other autosomes in regard to the recorded aberrations accompanying these disturbances.

Genomic and proteomic analysis of females with idiopathic recurrent early pregnancy loss (REPL) to find the unknown etiological factors involved. A case-control based study approach. Well-defined idiopathic REPL subjects (n=145) as well as control females (n=84) were included for the genotyping studies. For studying platelet proteome profiles, 25 cases and 10 controls were included. Polymorphisms in detoxification genes (NAT1, NAT2, CYP1A1, CYP2D6, SULT1A1, CYP17, CYP19, aryl hydrocarbon receptor, aryl hydrocarbon receptor repressor), vasoregulatory genes (eNOS, VEGF, anandamide hydrolase) and genes involved in blood homeostasis (Prothrombin, Factor V Leiden) were analyzed and their significance was estimated using a two tailed Fisher’s P-value at 95% significance level. Haplotype analysis of the unphased data using expectation-maximization was done wherever necessary. Platelet proteome analysis was carried out after isolation and solublization of platelets. Two dimensional gel electrophoresis using 3-10 range IPG strips and 12% SDS-PAGE was used for the separation of the proteins. Polymorphisms in CYP1A1 (C4887A and T6235C) showed significant association with REPL as evidenced by logistic regression and haplotype analysis. Novel variants were observed in CYP2D6, anandamide hydrolase, eNOS and were found to be associated with REPL. Apart from these results, present study revealed the lack of association between REPL with other variants pressing the need to consider the ethnic background in epidemiological studies. Proteome analysis of platelets revealed a differential expression pattern in three proteins with approximate molecular masses of 65kDa, 35kDa and 20kDa which were exclusively present in REPL females. Present study revealed certain novel and already reported polymorphisms in a multitude of genes to be associated with the risk of REPL. A role of genetic factor in REPL is further strengthened by the proteome analysis of platelets.

OBJECTIVE:To establish the risk associated with mutations in the coding region of GDF9 gene in Indian women with ovarian failure. DESIGN:This case-control study was designed for mutational analysis of the GDF9 coding region in a cohort of women with premature ovarian failure (n = 127), primary amenorrhea (n = 58), and secondary amenorrhea (n = 10) compared with controls (n = 220). RESULTS:This case-control study revealed eight mutations in the GDF9 gene, including five novel mutations: c.1-8C>T, c.199A>C (p.Lys67Glu), c. 205C>T, c.646G>A (p.Val216Mat), and c.1353C>T, and three documented mutations: c.398-39C>G, c.447C>T, and c.546G>A. Missense mutation c.199A>C was present in 4 of 127 premature ovarian failure (POF) cases and 1 of 10 secondary amenorrhea cases. The c.646G>A mutation was present in two POF cases. Both missense mutations were absent in controls. Genotype distribution of c.447C>T was significantly different in POF cases than controls (chi(2) = 5.93, P = 0.05). We chose two frequent single-nucleotide polymorphisms (c.398-39C>G, c.447C>T) for haplotyping and found that the C-T haplotype was significantly higher in patients (P = 0.03), whereas the C-C haplotype was representative of the control group. CONCLUSIONS:We report two rare missense mutations, c.199A>C and c.646G>A, which are associated with ovarian failure. The presence of the c.447>T mutation might indicate a higher risk for POF. Haplotype C-T was significantly associated with ovarian failure, whereas the C-C haplotype was representative of the control group.

The prevalence of chromosomal abnormalities in azoospermic and oligoastheno-teratozoospermic infertile men of South Indian origin undergoing assisted reproductive technologies was evaluated. In addition, the study, aimed to investigate new abnormal karyotypes involving autosomes in azoospermia and sex chromosomes in oligoastheno-teratozoospermic individuals that are supposed to be rare: Metaphase chromosomes of 744 infertile men, including 272 men with azoospermia and 472 men with oligoastheno-teratozoospermia (OAT), were analysed using Giemsa-trypsin-Giemsa banding and fluorescence in-situ hybridization (FISH) wherever necessary. Chromosomal abnormalities were observed in 59 (7.9%) individuals of the total studied population. Among these, 30 out of 272 (11.0%) azoospermic men and 29 out of 472 (6.1%) infertile men with OAT showed chromosomal abnormalities. A strong and statistically significant association (OR = 1.89; P = 0.0235) of chromosomal abnormalities and sex chromosome abnormalities (OR = 4.29; P = 0.001) with azoospermia when compared with OAT was observed. In addition, six autosomal abnormalities associated with azoospermia and two abnormalities involving Y chromosome, which include a novel karyotype (mos 46,XY/51,XYYYYYY) in OAT individuals, were detected.

Various factors cause spermatogenesis arrest in men and, in a large number of cases, the underlying reason still remains unknown. Little attention is paid to determining the genetic defects of varicocele-related infertility. The objective of our present study was to investigate the chromosomal abnormalities and Y chromosome microdeletions in infertile men of South Indian origin with varicocele and idiopathic infertility. Metaphase chromosomes of 251 infertile men with varicocele and unexplained infertility were analyzed using Giemsa-Trypsin-Giemsa (GTG) banding and fluorescence in situ hybridization (FISH). The microdeletions in 6 genes and 18 sequence-tagged-sites (STS) in the Yq region were screened using polymerase chain reaction (PCR) techniques. Out of 251 infertile men, 57 (22.7%) men were with varicocele, of which 8.77% were azoospermic, 26.31% were severely oligozoospermic, 21.05% were mildly oligozoospermic, and 43.85% were oligoasthenoteratozoospermic (OAT), and 194 (77.29%), with idiopathic infertility, of which 51% were azoospermic, 13.40% were severely oligozoospermic, 19.07% were mildly oligozoospermic, and 16.4% were with OAT. Genetic defects were observed in 38 (15.13%) infertile individuals, including 14 (24.56%) men with varicocele and 24 (12.37%) men with idiopathic infertility. The frequencies of chromosomal defects in varicocele and idiopathic infertility were 19.3% and 8.76%, respectively, whereas Y chromosome microdeletions were 5.26% and 3.60%, respectively. Overall rate of incidence of chromosomal anomalies and microdeletions in 251 infertile men were 11.5% and 3.98%, respectively, indicating a very significant higher association of genetic defects with varicocele than idiopathic male infertility. Our data also demonstrate that, among infertile men with varicocele, severely oligozoospermic and OAT men with varicocele have higher incidences of genetic defects than mildly oligozoospermic and azoospermic men.

Polymorphic variants in the phase I enzyme, cytochrome P450 gene, may lead to increased toxification, whereas polymorphisms in the phase II enzyme, glutathione S-transferase genes, may result in impaired detoxification. Alterations in the activities of phase I drug metabolizing enzymes and phase II detoxification enzymes may cause abnormal functioning and formation of follicular cysts in the ovaries and thus causing an imbalance in the hormone profiles. This study aimed to investigate the relationship between genetic polymorphisms of CYP1A1 (T6235C), GSTM1 and GSTT1 in South Indian women with polycystic ovaries (PCO) using polymerase chain reaction-restriction fragment length polymorphism. The frequencies of variants of these genes were studied in 180 women with confirmed PCO and in 72 healthy fertile women with successful pregnancy record. No significant difference was found between the frequencies of GSTM1 and GSTT1 null genotypes in PCO cases and healthy controls. However, CYP1A1 Msp I homozygous mutants were strongly associated (P = 0.0139) with increased susceptibility to PCO. Three genotype combinations, CYP1A1 (mt/mt) with GSTM1 [-] and GSTT1 [-], CYP1A1 (wt/mt) with GSTM1 [-] and GSTT1 [-] and CYP1A1 (mt/mt) with GSTM1 [-], GSTT1 [+], were also observed in women with PCO. In conclusion, the presence of hyperinducible CYP1A1 (T6235C) mutant genotype and its mutants in combination with GSTM1 and GSTT1 null genotypes might cause an imbalance between phase I and phase II enzymes, and therefore may represent a risk factor for PCO.

Aylamine-N-acetyl transferase is a phase II detoxification enzyme encoded by the gene NAT2. Single nucleotide polymorphism (SNP) changes from the wild type NAT2 *4 allele result in allelic variants *5, *6 and *7. Homozygotes for the NAT2 *4 wild type are fast acetylators; heterozygotes with one wild-type allele and a variant NAT2 *5, *6 or *7 allele have reduced enzyme activity and individuals with two variant alleles are slow acetylators. Previous studies have implicated NAT2 as a susceptibility factor in endometriosis. This study investigated the NAT2 allele frequencies and genotype distributions in 252 unrelated women with endometriosis and 264 controls of South Indian origin. No differences were found between the frequencies of fast and slow acetylators in cases (34.9% and 65.1%) and controls (33.3% and 66.7%). Two NAT2 genotypes *7/*7 (1.2%) and *5/*6/*7 (1.6%) were detected in endometriosis cases only. Four new combinations, 6D (481 + 590 mutation), 7C (590 + 857), 7D (590 + 803 + 857) and 7E (481 + 590 + 803 + 857) were detected, which have not been reported earlier. Similar genotype and phenotype results were obtained in 33 affected sister-pairs. The case-control data from this study suggest there is no association between endometriosis and NAT2 in South Indian women; however, two new variant genotypes and seven SNP combinations were also identified in cases only, which suggests that the gene may still have some as yet undetermined role in the disease.

Background: We investigated the relationship between idiopathic recurrent pregnancy loss (RPL) and genetic polymorphisms in phase I and phase II detoxification genes which include CYP1A1, CYP2D6, GSTM1, GSTP1 and GSTT1. Method: A case-control study comprised 160 females with RPL and 63 healthy controls with a successful reproductive history. Results: The CYP1A1 variant allele was present at frequencies of 0.61 and 0.44 in cases and controls, respectively (odds ratio = 1.93; P=0.023, 95% confidence interval 1.10-3.38). The CYP2D6 variant allele was present at a frequency of 0.17 in females with RPL, while in the control population the frequency was 0.16. The GSTM1 and GSTT1 null genotypes were present at frequencies of 0.39 and 0.26 in RPL cases, whereas in controls the frequencies were 0.37 and 0.17, respectively. The mutant GSTP1 frequencies in case and control women were 0.38 and 0.40, respectively. We report a significant association of the CYP1A1*2A allele with RPL which is confirmed by logistic regression analysis. No association was observed for the other polymorphisms or in their combinations studied. Conclusions: The present study suggests the occurrence of the CYP1A1*2A allele as a probable risk factor in idiopathic recurrent miscarriages.