D-Aspartate, an abundant d-amino acid enriched in neuroendocrine tissues, can be degraded by d-aspartate oxidase (Ddo). To elucidate the function of d-aspartate, we generated mice with targeted deletion of Ddo (Ddo−/−) and observe massive but selective augmentations of d-aspartate in various tissues. The pituitary intermediate lobe, normally devoid of d-aspartate from endogenous Ddo expression, manifests pronounced increases of immunoreactive d-aspartate in Ddo−/− mice. Ddo−/− mice show markedly diminished synthesis and levels of pituitary proopiomelanocortin/α-MSH, associated with decreased melanocortin-dependent behaviors. Therefore, Ddo is the endogenous enzyme that degrades d-aspartate, and Ddo-enriched organs, low in d-aspartate, may represent areas of high turnover where d-aspartate may be physiologically important.

D-serine and D-aspartate are important regulators of mammalian physiology. D-aspartate is found in nervous and endocrine tissue, specifically in hypothalamic supraoptic and paraventricular nuclei, pituitary, and adrenal medullary cells. Endogenous D-aspartate is selectively degraded by D-aspartate oxidase. We previously reported that adult male mice lacking the gene for D-aspartate oxidase (Ddo(-/-) mice) display elevated concentrations of D-aspartate in several neuronal and neuroendocrine tissues as well as impaired sexual performance and altered autogrooming behaviour. In the present study, we analyzed behaviours relevant to affect, cognition, and motor control in Ddo(-/-) mice. Ddo(-/-) mice display deficits in sensorimotor gating and motor coordination as well as reduced immobility in the forced swim test. Basal corticosterone concentrations are elevated. The Ddo(-/-) mice have D-aspartate immunoreactive cells in the cerebellum and adrenal glands that are not observed in the wild-type mice. However, no differences in anxiety-like behaviour are detected in open field or light-dark preference tests. Also, Ddo(-/-) mice do not differ from wild-type mice in either passive avoidance or spontaneous alternation tasks. Although many of these behavioural deficits may be due to the lack of Ddo during development, our results are consistent with the widespread distribution of D-aspartate and the hypothesis that endogenous D-aspartate serves diverse behavioural functions.

We have molecularly cloned a calcium sensing receptor (CaSR) from a rat striatal cDNA library. Rat CaSR displays 92% overall homology to its bovine counterpart with seven putative transmembrane domains characteristic of the superfamily of guanine nucleotide-binding proteins and significant homology with the metabotropic glutamate receptors. Northern blot analysis reveals two transcripts in thyroid, kidney, lung, ileum, and pituitary. In brain highest regional expression of the RNA occurs in the hypothalamus and the corpus striatum. Immunohistochemistry reveals discrete punctate localizations throughout the brain that appear to be associated with nerve terminals. No staining is evident in cell bodies of neurons or glia. Cerebral arteries display an intense network ofCaSR immunoreactive fibers associated with vessel innervation. CaSR on nerve terminal membranes may regulate neurotransmitter disposition in response to Ca21 levels in the synaptic space. Calcium ions are crucial for a variety of neuronal functions. Neurotransmitter release is triggered by Ca2+ entry in nerve terminals, while Ca2+ release by the inositol 1,4,5-trisphosphate receptor or the ryanodine receptor regulates intracellular signal transduction. Numerous peripheral organs monitor extracellular Ca2+ levels to regulate the disposition of calcium in tissues such as the parathyroid gland, kidney, and bone (1). Recently, Brown et al (2) cloned a Ca2+ sensing receptor (CaSR) from bovine parathyroid tissue. CaSR, a 120-kDa membrane protein, possesses a very large extracellular N-terminal domain that resembles metabotropic glutamate receptors (mGluRs) and seven transmembrane domains (TMs) as in guanosine triphosphate binding protein (G protein)-coupled receptors. When expressed in oocytes, the protein is activated by Ca2+ leading to the G-protein-dependent activation of phospholipase C. Point mutations in CaSR are linked to diseases that display abnormalities in blood Ca2+ disposition (3, 4). Northern blot analysis reveals expression of CaSR in several tissues other than the parathyroid gland, including brain (2). In the present study, we have molecularly cloned the rat form of CaSR from a brain cDNA library.t With an antiserum to rat CaSR, we have localized CaSR selectively to nerve terminals in brain and blood vessels. MATERIALS AND METHODS Cloning and Sequencing of a Rat cDNA for CaSR. A rat striatal cDNA library constructed in A ZAPII (Stratagene) was screened (1,000,000 phages) with a 32P-labeled DNA (5) containing two overlapping oligodeoxynucleotides (5'TTCCTCCGCACCATACCCAATGATGAACACCAGGCCACGGCCATGGCTG and 5'-GCCCACCCAGTTCCAGCGGAAGTACTCGATGATGTCAGCCATGGCCG) derived from the bovine CaSR sequence, i.e., within the The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact. putative hydrophobic domain located in the extracellular domain (2). Twenty positive clones were further plaquepurified and rescued plasmids [Bluescript KS(+)] containing cDNA inserts were sequenced by the fluorescent terminator method of cycle sequencing on an Applied Biosystems model 373a automated DNA sequencer. Sequencing of a 6.5-kb cDNA insert derived from clone SRCa33 indicated an open reading frame of 1079 aa beginning with an initiator consensus sequence methionine (AACGCTATGG) (6) starting from Met1 (Fig. 1), with a nonsense codon (TGA) at position -18, and ending with a stop codon (TAA) at position 3238. Northern Blot Analysis. RNAs or poly(A)+ mRNAs from adult male Sprague-Dawley rats were prepared and subjected to Northern blot analysis as described (5) except that 50% (vol/vol) formamide was used in the prehybridization and in the hybridization buffers. A DNA probe 32P-labeled by nicktranslation and corresponding to the nucleotide sequence encoding aa 1-1079 (Fig. 1) was used. Blots were washed for two 20-min periods in 2x standard saline citrate (SSC)/0.1% SDS at 42°C and then in 0.2x SSC/0.1% SDS for two 20-min periods at 42°C, for two 15-min periods at 55°C, and for one 10-min period at 65°C. Blots were exposed to film for 4 days at -800C. Expression in Human Embryonic Kidney (HEK)-293 cells. A 3760-bp fragment containing the full-length coding sequence of the rat CaSR was excised from the 6.5-kb cDNA insert of the Bluescript plasmid, purified by Geneclean II (Bio 101), and ligated at the Xho I-Xba I sites of the expression vector pRK5. HEK-293 cells were transfected by using the Ca2+ phosphate procedure and cells were harvested for Western blot analysis. Generation of Polyclonal Antisera to Rat CaSR. A synthetic peptide (KALAWHSSAYGPDQRAQ) based on the rat CaSR sequence (Fig. 1) was synthesized, conjugated to bovine serum albumin via glutaraldehyde, and injected in rabbits to raise antiserum (7). Antibodies were affinity-purified on an ovalbumin-CaSR peptide conjugate immobilized on CNBractivated Sepharose. Western Blot Analysis and Immunochemistry. Tissues or cells were homogenized in ice-cold 50 mM Tris HCl, pH 7.4/1 mM EDTA/aprotinin (10 ,tg/ml)/leupeptin (10 ,ug/ml)/ phenylmethylsulfonyl fluoride (100 ,ug/ml)/benzamidine (60 ,ug/ml) and centrifuged at 100,000 x g for 1 hr. Pellets were resuspended in buffer, and proteins were separated on a 7.5% polyacrylamide gel, transferred to immobilon-P membranes (Millipore), probed overnight with affinity-purified antibodies (2 ,tg/ml), and developed with enhanced chemiluminescence (Renaissance; DuPont/NEN). For preabsorption experiAbbreviations: CaSR, calcium sensing receptor; G protein, guanosine triphosphate binding protein; GFAP, glial fibrillary acidic protein; mGluR, metabotropic glutamate receptor; TM, transmembrane domain. *To whom reprint requests should be addressed. tThe sequence reported in this paper has been deposited in the GenBank data base (accession no. U20289).

Ibogaine is a tremorigenic hallucinogen that has been proposed for clinical use in treating addiction. We previously reported that ibogaine, administered systemically, produces degeneration of a subset of Purkinje cells in the cerebellum, primarily within the vermis. Ablation of the inferior olive affords protection against ibogaine-induced neurotoxicity leading to the interpretation that ibogaine itself is not directly toxic to Purkinje cells. We postulated that ibogaine produces sustained excitation of inferior olivary neurons that leads to excessive glutamate release at climbing fiber terminals, causing subsequent excitotoxic injury to Purkinje cells. The neuronal degeneration induced by ibogaine provides an animal model for studying excitotoxic injury in order to analyze the contribution of glutamate receptors to this injury and to evaluate neuroprotective strategies. Since non-N-methyl-D-aspartate (NMDA) receptors mediate Purkinje cell excitation by climbing fibers, we hypothesized that 1-4-aminophenyl-methyl-7,8-methylenedioxy-5H-2,3-benzodiazepine (GYKI-52466), which antagonizes non-NMDA receptors, may have a neuroprotective effect by blocking glutamatergic excitation at climbing fiber synapses. To test this hypothesis, rats were administered systemic ibogaine plus GYKI-52466 and the degree of neuronal injury was analyzed in cerebellar sections. The results indicate that the AMPA antagonist GYKI-52466 (10 mg/kg i.p. x 3) does not protect against Purkinje cell injury at the doses used. Rather, co-administration of GYKI-52466 with ibogaine produces increased toxicity evidenced by more extensive Purkinje cell degeneration. Several hypotheses that may underlie this result are discussed. Although the reason for the increased toxicity found in this study is not fully explained, the present results show that a non-NMDA antagonist can produce increased excitotoxic injury under some conditions. Therefore, caution should be exercised before employing glutamate antagonists to reduce the risk of neuronal damage in human clinical disorders. Moreover, the contribution of different glutamate receptors to excitotoxic injury is complex and merits further analysis.

Purpose. Penclomedine (PEN), a multichlorinated α-picoline derivative which is metabolized to highly reactive alkylating species, was selected for clinical development due to its prominent activity against a wide range of human tumor xenografts when administered either parentally or orally. Its principal dose-limiting toxicity in preclinical and clinical studies has been neurocerebellar toxicity, which has been related to the magnitude of peak plasma PEN concentrations, but not to plasma concentrations of its putative principal alkylating metabolite, 4,o-demethylpenclomedine (DMPEN). These observation, as well as PEN's toxicologic, pharmacologic, and tissue distribution profiles, have suggested that the parent compound is primarily responsible for cerebellar toxicity. The studies described in this report were undertaken to characterize the neuropathology of PEN neurotoxicity, with a long-term goal of developing strategies to maximize its therapeutic index. Design. Male Sprague–Dawley rats were treated with therapeutically relevant doses of PEN, orally and intraperitoneally (i.p.), on various administration schedules, and DMPEN administered i.p. The animals were monitored for neurotoxicity, and brain sections were examined for neuropathology, particularly Purkinje cell loss and neuronal injury. Brain sections were stained using standard histochemical techniques and immunostained with OX-42 to detect microglial cells that are activated following neuronal damage, and calbindin D28K, a calcium-binding protein expressed by cerebellar Purkinje cells. Results. Dose-related neurocerebellar toxicity associated with parasagittal bands of Purkinje cell degeneration and microglial activation in the cerebellar vermis were evident in rats treated with PEN 100–400 mg/kg i.p. as a single dose. Neuronal injury was not observed in other regions of the brain. Furthermore, neither clinical nor histopathological evidence of cerebellar toxicity was apparent in rats treated with similar total doses of PEN administered i.p. on a daily×5-day dosing schedule. Similar histological findings, in an identical neuroanatomical distribution, were observed in rats treated with PEN orally; however, the magnitude of the neuronal toxicity was much less than in animals treated with equivalent doses of PEN administered i.p. Although acute lethality occurred in some rats treated with equimolar doses of DMPEN as a single i.p. treatment, surviving animals exhibited neither signs nor histopathological evidence of neurocerebellar toxicity. Conclusions. PEN produces selective dose- and schedule-dependent Purkinje cell degeneration in the cerebellar vermis of rats, whereas therapeutically relevant doses of PEN administered orally are better tolerated and produce less neurocerebellar toxicity. In addition, roughly equivalent, albeit intolerable, doses of the major active metabolite DMPEN, which was lethal to some animals, produced neither clinical manifestations of neurocerebellar toxicity nor Purkinje cell loss. These results support a rationale for investigating whether PEN administered orally, which may undergo significant first-pass metabolism to DMPEN and other less toxic intermediates, or treatment with DMPEN, itself, may result in less neurocerebellar toxicity and superior therapeutic indices than PEN administered parenterally.

Little is known about the role of class 3 semaphorins in the development of CNS circuitry. Several class 3 semaphorins, including semaphorin 3F (Sema3F) bind to the receptor neuropilin-2 to confer chemorepulsive responses in vitro. To understand the role of Sema3F in the establishment of neural circuitry in vivo, we have generated sema3F null and sema3F conditional mutant mice. Inspection of the peripheral nervous system in sema3F null mice reveals that Sema3F is essential for the proper organization of specific cranial nerve projections. Analysis of the CNS in sema3F null mice reveals a crucial role for Sema3F in the rostral forebrain, midbrain, and hippocampus in establishing specific Npn-2 (neuropilin-2)-expressing limbic tracts. Furthermore, we identify Sema3F and Npn-2 as the first guidance cue-receptor pair shown to be essential for controlling the development of amygdaloid circuitry. In addition, we provide genetic evidence in vertebrates for a neuronal requirement of a soluble axon guidance cue in CNS axon guidance. Our data reveal a requirement for neuronal Sema3F in the normal development of the anterior commissure in the ventral forebrain and infrapyramidal tract in the hippocampus. Thus, our results show that Sema3F is the principal ligand for Npn-2-mediated axon guidance events in vivo and is a critical determinant of limbic and peripheral nervous system circuitry.

The experiments strongly suggested that the reason why Purkinje cells die so easily after global brain ischemia relates to deficiencies in aldolase C and EAAT4 that allow them to survive pathologically intense synaptic input from the inferior olive after the restoration of blood flow. This conclusion is based on: (a) the remarkably tight correspondence between the regional absence of aldolase C and EAAT4 in Purkinje cells and the patterned loss of Purkinje cells after a bout of global brain ischemia; (b) the necessity of the olivocerebellar pathway for the ischemic death of Purkinje cells; and (c) the build-up of pathologically synchronous and high-frequency burst activity within the inferior olive during recovery from ischemia. Indeed, the correspondence between the absence of aldolase C and EAAT4 to sensitivity to ischemia could be demonstrated for zones of Purkinje cells as small as two neurons. A second finding was that Purkinje cells are not uniformly sensitive to transient ischemia, since they die most frequently in zones where aldolase C and EAAT4 are absent. One implication of the experiment is that factors beyond the unique synaptic and membrane properties of Purkinje cells play an important role in determining this neuron's high sensitivity to ischemia. The data strongly imply that two properties of Purkinje cells that make them susceptible to ischemic death are their reduced capability to sequester glutamate and reduced ability to generate energy during anoxia. The patterned death of Purkinje cells is sufficient to induce a form of audiogenic myoclonus, as determined with a neurotoxic dose of ibogaine. Ibogaine-induced myoclonus is recognized behaviorally as a reduced ability to habituate to a startle stimulus and resembles the myoclonic jerk of rats during recovery from a prolonged bout of global brain ischemia. Commonalities of ischemia and ibogaine-induced neurodegeneration are the intricately striped Purkinje cell loss in the posterior lobe and a nearly complete deafferentation of the lateral aspect of the fastigial nucleus from the cerebellar cortex, in particular the dorsolateral protuberance. Thus, the data point strongly to a cerebellar contribution to audiogenic myoclonus. Single-neuron electrophysiology experiments in monkeys have demonstrated that the evoked activity in the deep cerebellar nuclei occurs too late to initiate the startle response (60) and electromyography of the postischemic myoclonus of rats corroborates this view (see Chapter 31) (20). However, the nearly complete loss of GABAergic terminals in the dorsolateral protuberance after Purkinje cell death would be expected to dramatically increase its tonic firing and the background excitation of the brain-stem structures that it innervates. The fastigial nucleus innervates a large number of autonomic and motor structures in the brainstem and diencephalon, including the ventrolateral nucleus of the thalamus and the gigantocellular reticular nucleus in the medulla--structures that have been implicated in human posthypoxic myoclonus (6, 7). We propose that the posthypoxic myoclonic jerk of rats is, at least in part, due to disinhibition of the fastigial nucleus produced by patterned Purkinje cell death in the vermis. The argument is as follows: the loss of GABAergic inhibition in the fastigial nucleus after ischemia leads to diaschisis of the motor thalamus and reticular formation which, in turn, is responsible for enhanced motor excitability and myoclonus. That the audiogenic myoclonus after global brain ischemia in the rat gradually resolves over a period of 2 to 3 weeks is consistent with this view, as restoration of background excitability after CNS damage in rats has been documented to occur within this time-frame (61). Our view brings together the physiologic finding that posthypoxic myoclonus appears to originate in the sensory-motor cortices and/or reticular formation with the consistent anatomical finding of Purkinje cell loss after ischemia, and explains the puzzle of Marsden's unique cases of myoclonus associated with coeliac disease (1). Moreover, our argument is consistent with findings both in rats (62, 63) and humans (64) that damage to the vermis impairs the long-term habituation of the startle reflex. It remains to be determined whether the pathologically enhanced startle responses after vermal damage resemble brain-stem reticular or cortical myoclonus at the electrophysiologic level of analysis. What is the purpose of the regional expression of aldolase C and EAAT4 in Purkinje cells? The close correspondence between the spatial distribution of aldolase C and the parasagittal anatomy of the cerebellum (48) has led to the view that aldolase C may help specify connectivity during development. While the present experiments do not address this issue, they underscore the fact that aldolase plays a fundamental role in metabolism. Because Purkinje cells have a repressed expression of aldolase A (31), whatever role the absence of aldolase C may play during development comes at the price of metabolic frailty later in adulthood. From another point of view, aldolase C and EAAT4 appear to confer upon Purkinje cells the ability to survive their own climbing fiber. Indeed, climbing fibers form a distributed synapse that synchronously releases glutamate (or aspartate) at all levels of the dendritic tree simultaneously (65, 66). Such synchronous activation triggers calcium influx throughout the Purkinje cell dendrites at a magnitude that is unparalleled in the nervous system (12), and, thus, places an extraordinarily high metabolic demand on the Purkinje cell. The apparently reduced level of aldolase in a subpopulation of Purkinje cells provides the condition for energy failure and death during anoxia so long as the climbing fibers are intact or when climbing fiber activation is pharmacologically enhanced under normoxic conditions, such as after ibogaine (53-56). Lastly, the argument that diaschisis produced by patterned cerebellar degeneration leads to thalamo-cortical and reticular hyperexcitability agrees with C. David Marsden and his colleagues' bold demonstration of an inhibitory influence of cerebellar cortex on motor cortex in humans (67). Our anatomic data indicate that the spatially distinct zones of Purkinje cells, which are killed by global brain ischemia, may be the origin of such inhibition.

Type 1 inositol 1,4,5-trisphosphate receptors are phosphorylated by cyclic-AMP-dependent protein kinase A at serines 1589 and 1755, with serine 1755 phosphorylation greatly predominating in the brain. Inositol 1,4,5-trisphosphate receptor protein kinase A phosphorylation augments Ca2+ release. To assess type 1 protein kinase A phosphorylation dynamics in the intact organism, we developed antibodies selective for either serine 1755 phosphorylated or unphosphorylated species. Immunohistochemical studies reveal marked variation in localization. For example, in the hippocampus the phosphorylated type 1 inositol 1,4,5-trisphosphate receptor is restricted to CA1, while the unphosphorylated receptor occurs ubiquitously in CA1-CA3 and dentate gyrus granule cells. Throughout the brain the phosphorylated type 1 inositol 1,4,5-trisphosphate receptor is selectively enriched in dendrites, while the unphosphorylated receptor predominates in cell bodies. Focal cerebral ischemia in rats and humans is associated with dephosphorylation of type 1 inositol 1,4,5-trisphosphate receptors, and glutamatergic excitation of cerebellar Purkinje cells mediated by ibogaine elicits dephosphorylation of type I inositol 1,4,5-trisphosphate receptors that precedes evidence of excitotoxic neuronal degeneration. We have demonstrated striking variations in regional and subcellular distribution of inositol 1,4,5-trisphosphate receptor phosphorylation that may influence normal physiological intracellular Ca2+ signaling in rat and human brain. We have further shown that the subcellular distribution of inositol 1,4,5-trisphosphate receptor phosphorylation in neurons is regulated by excitatory neurotransmission, as well as excitotoxic insult and neuronal ischemia-reperfusion. Phosphorylation dynamics of type 1 inositol 1,4,5-trisphosphate receptors may modulate intracellular Ca2+ release and influence the cellular response to neurotoxic insults. (C) 2001 IBRO. Published by Elsevier Science Ltd. All rights reserved.

The cerebellum is known to influence motor behavior and to enable smooth, coordinated movements. Recent evidence also suggests that the cerebellum contributes to non-motor behavior, including components of cognition and regulation of affective state. This review summarizes the organization and circuitry of the cerebellum as a basis for understanding newly emerging concepts about the function of this neuronal system. The cerebellum consists of several divisions with separate functions. One region is associated with the vestibular system and another with brainstem and spinal cord. A third region, the cerebrocerebellum, has extensive interconnections with cerebral cortex and is likely to be involved in motor coordination and regulation of non-motor behavior. The cerebellar cortex is made up of radial modules of interconnected neurons. The Purkinje cell is the principle integrating neuron and focal point of each module. Other neuron types include the granule cell and three inhibitory interneurons. The Purkinje cell integrates excitatory inputs from climbing and parallel fibers, while its axon modulates activity of neurons in the deep nuclei, which represents the final outflow from cerebellum to other parts of the brain. Cerebellar circuitry exhibits a strong parasagittal organization based on climbing fiber input and the distributions of neuronal proteins and neuronal vulnerability to insults. The combination of this parasagittal circuitry with the mediolateral course of parallel fibers results in a Cartesian coordinate system which is likely to be a crucial factor in its signal processing function. Although numerous details of cerebellar microcircuitry, synaptic transmission and signal transduction have been determined, the functional contribution of cerebellar signalling to brain function remains highly enigmatic.

Nitric oxide (NO) is a new intercellular messenger that occurs naturally in the brain without causing overt toxicity. Yet, NO has been implicated as a mediator of cell death in cell death. One explanation is that ischemia causes overproduction of NO, allowing it to react with superoxide to form the potent oxidant peroxynitrite. To address this question, we used immunohistochemistry for citrulline, a marker for NO synthase activity, and 3-nitrotyrosine, a marker for peroxynitrite formation, in mice subjected to reversible middle cerebral artery occlusion. We show that ischemia triggers a marked augmentation in citrulline immunoreactivity but more so in the peri-infarct than the infarcted tissue. This increase is attributable to the activation of a large population (∼80%) of the neuronal isoform of NO synthase (nNOS) that is catalytically inactive during basal conditions, indicating a tight regulation of physiological NO production in the brain. In contrast, 3-nitrotyrosine immunoreactivity is restricted to the infarcted tissue and is not present in the peri-infarct tissue. In nNOSΔ/Δmice, known to be protected against ischemia, no 3-nitrotyrosine immunoreactivity is detected. Our findings provide a cellular localization for nNOS activation in association with ischemic stroke and establish that NO is not likely a direct neurotoxin, whereas its conversion to peroxynitrite is associated with cell death.

This chapter depicts a systems approach to analyze the manifestations and determinants of excitotoxic injury in the central nervous system (CNS) as illustrated by a recently described experimental model of excitotoxicity in cerebellum. In this model of neurotoxicity, administration of certain indole alkaloid derivatives (e.g., harmaline or ibogaine) leads to excitotoxic insult in a subset of neurons in cerebellar cortex. The resulting neuronal injury is highly selective for Purkinje cells and exhibits a unique, spatial pattern of degeneration. Complementary to data presented in other chapters of this volume focusing on the molecular and biochemical mechanisms of neuronal injury and death (see chapters by Dykens, Leist and Nicotera, Rosen and Casciola-Rosen, and Freeman), the present chapter takes a systems approach in order to characterize the role of neuronal circuitry in the production of selective neuronal injury (see also chapter by Olney and Ishimaru and, for a developmental systems perspective, see chapter by Burek and Oppenheim). The model of neurotoxicity described here exemplifies how a particular form of neuronal circuitry can determine the location of excitotoxic injury in the brain, the specific neurons affected and the spatial distribution of degenerating neurons. This model provides insights into the glial reactions induced by injury to a particular type of neuron, and it demonstrates that the pattern of termination of synaptic inputs to a neuron is an important determinant of neuronal vulnerability.

d-Serine is localized in mammalian brain to a discrete population of glial cells near NMDA receptors, suggesting thatd-serine is an endogenous agonist of the receptor-associated glycine site. To explore this possibility, we have compared the immunohistochemical localizations ofd-serine, glycine, and NMDA receptors in rat brain. In the telencephalon,d-serine is concentrated in protoplasmic astrocytes, which are abundant in neuropil in close vicinity to NMDA receptor 2A/B subunits. Ultrastructural examination of the CA1 region of hippocampus revealsd-serine in the cytosolic matrix of astrocytes that ensheath neurons and blood vessels, whereas NR2A/B is concentrated in dendritic spines. By contrast, glycine immunoreactivity in telencephalon is the lowest in brain. During postnatal week 2,d-serine levels in cerebellum are comparable to those in adult cerebral cortex but fall to undetectable levels by day 26. During week 2, we observe parallel ontogeny ofd-serine in Bergmann glia and NR2A/B in Purkinje cells, suggesting a role for astrocyticd-serine in NMDA receptor-mediated synaptogenesis.d-Serine in the radial processes of Bergmann glia is also well positioned to regulate NMDA receptor-dependent granule cell migration. In the inner granule layer,d-serine is found transiently in protoplasmic astrocytes surrounding glomeruli, where it could regulate development of the mossy fiber/granule cell synapse.d-Serine seems to be the endogenous ligand of glycine sites in the telencephalon and developing cerebellum, whereas glycine predominates in the adult cerebellum, olfactory bulb, and hindbrain.

Ibogaine, an indole alkaloid that causes hallucinations, tremor, and ataxia, produces cerebellar neurotoxicity in rats, manifested by degeneration of Purkinje cells aligned in narrow parasagittal bands that are coextensive with activated glial cells. Harmaline, a closely related alkaloid that excites inferior olivary neurons, causes the same pattern of Purkinje cell degeneration, providing a clue to the mechanism of toxicity. We have proposed that ibogaine, like harmaline, excites neurons in the inferior olive, leading to sustained release of glutamate at climbing fiber synapses on Purkinje cells. The objective of this study was to test the hypothesis that increased climbing fiber activity induced by ibogaine mediates excitotoxic Purkinje cell degeneration. The inferior olive was pharmacologically ablated in rats by a neurotoxic drug regimen using 3-acetylpyridine, and cerebellar damage attributed to subsequent administration of ibogaine was analyzed using immunocytochemical markers for neurons and glial cells. The results show that ibogaine administered after inferior olive ablation produced little or no Purkinje cell degeneration or glial activation. That a lesion of the inferior olive almost completely prevents the neurotoxicity demonstrates that ibogaine is not directly toxic to Purkinje cells, but that the toxicity is indirect and dependent on integrity of the olivocerebellar projection. We postulate that ibogaine-induced activation of inferior olivary neurons leads to release of glutamate simultaneously at hundreds of climbing fiber terminals distributed widely over the surface of each Purkinje cell. The unique circuitry of the olivocerebellar projection provides this system with maximum synaptic security, a feature that confers on Purkinje cells a high degree of vulnerability to excitotoxic injury.

We have studied abnormalities in the tangential and radial expansion of the cerebral cortex during fetal development in the trisomy 16 (Ts16) mouse, a model for human trisomy 21 (Down syndrome). Slowed tangential expansion of the neuroepithelium in Ts16 resulted in a reduction of final telencephalic size and is predicted to decrease the number of radial cortical units in the mature brain. In addition, radial growth of the Ts16 cortex was delayed at the time of peak cortical neurogenesis in normal mice, but by embryonic day 18 the cortex reached normal thickness. Because mouse chromosome 16 shares many genes with human chromosome 21, abnormalities in Ts16 brain development may parallel abnormalities in trisomy 21.

Using an antibody highly specific for D-serine conjugated to glutaraldehyde, we have localized endogenous D-serine in rat brain. Highest levels of D-serine immunoreactivity occur in the gray matter of the cerebral cortex, hippocampus, anterior olfactory nucleus, olfactory tubercle, and amygdala. Localizations of D-serine immunoreactivity correlate closely with those of D-serine binding to the glycine modulatory site of the N-methyl-D-aspartate (NMDA) receptor as visualized by autoradiography and are inversely correlated to the presence of D-amino acid oxidase. D-Serine is enriched in process-bearing glial cells in neuropil with the morphology of protoplasmic astrocytes. In glial cultures of rat cerebral cortex, D-serine is enriched in type 2 astrocytes. The release of D-serine from these cultures is stimulated by agonists of non-NMDA glutamate receptors, suggesting a mechanism by which astrocyte-derived D-serine could modulate neurotransmission. D-Serine appears to be the endogenous ligand for the glycine site of NMDA receptors.

We have molecularly cloned a calcium sensing receptor (CaSR) from a rat striatal cDNA library. Rat CaSR displays 92% overall homology to its bovine counterpart with seven putative transmembrane domains characteristic of the superfamily of guanine nucleotide-binding proteins and significant homology with the metabotropic glutamate receptors. Northern blot analysis reveals two transcripts in thyroid, kidney, lung, ileum, and pituitary. In brain highest regional expression of the RNA occurs in the hypothalamus and the corpus striatum. Immunohistochemistry reveals discrete punctate localizations throughout the brain that appear to be associated with nerve terminals. No staining is evident in cell bodies of neurons or glia. Cerebral arteries display an intense network of CaSR immunoreactive fibers associated with vessel innervation. CaSR on nerve terminal membranes may regulate neurotransmitter disposition in response to Ca2+ levels in the synaptic space.