An experiment was conducted with 'Grand Naine' banana under organic cultivation for developing a strategy to sustain long-term fertility and health of soil and to enhance banana yield, fruit quality and fruit shelf-life. The experiment consisted of four treatments in a completely randomized block design with three replications, each consisting of 40 plants over two seasons. In all the four treatments, a uniform nutrient dosage of 200 g N + 100 g P2O5 + 300 g K2O was applied per plant but through application of different combinations of various organic manures as well as pure inorganic fertilizer source as a control. The treatments included: T1 - 10 kg farmyard manure (FYM) + 1.25 kg neem cake (NC) + 5 kg vermicompost (VC) + 3.75 kg of wood ash (WA) plant(-1), T2 - 5 kg poultry manure ( PM) + 1 kg groundnut cake (GC) + 3 kg rural compost (RC) + 3.5 kg WA plant(-1), T3 - 10 kg sugarcane pressmud (SP) + 1 kg castor cake (CC) + 5 kg RC + 4 kg WA plant(-1), and T4 - 435 g urea + 500 g single super phosphate + 500 g muriate of potash plant(-1). A more precise match in nutrient release from the soil with uptake by the plants was noticed in T2 than the other organic treatments. At harvesting, the T2 recorded bunch weight of 25.3 kg which was on a par with that of 100% inorganic fertilizer application (25.9 kg). The same treatment (T2) recorded higher values of fruit quality parameters and optimum levels of soil biological properties. Thus, the combination of 5 kg PM + 1 kg GC + 3 kg RC + 3.5 kg WA plant-1 was adjudged to be optimum for organic banana farming.

Fusarium wilt, caused by the fungus Fusarium oxysporum f. sp. cubense, is the most serious pandemic disease of banana. In this study, we report the draft genome of F. oxysporum f. sp. cubense vegetative compatibility group (VCG) 01213/16 of strain tropical race 4 (TR4) that infects the Cavendish (AAA) group of banana collected from the subtropical region in India. The genome assembly of SFoc TR4 comprises 47,384,463 bp with 4,034 contigs and 15,508 protein-coding regions. Based on VCG analysis, the fungal isolate belongs to F. oxysporum f. sp. cubense TR4 but the genome sequence of SFoc TR4 shows differences in secreted-in-xylem (SIX) protein gene clusters (specifically, SIX8) in comparison with the reference genome of F. oxysporum f. sp. lycopersici and F. oxysporum f. sp. cubense TR4.

Bananas are vital for food security in many countries, and half of banana production relies solely on 'Cavendish' (AAA), which is presently threatened by the fungal pathogen Fusarium oxysporum f. sp. cubense (Foc) tropical race 4. This particular virulent Foc strain was also found to attack other banana varieties of commercial importance. As there is no single effective management practice available so far, this study was undertaken to determine resistant sources from the genotype collection available at the ICAR-National Research Centre for Banana, Tiruchirappalli, Tamil Nadu, India for direct use by farmers and/or in breeding programmes to develop resistant hybrids. A total of 258 genotypes of different ploidies and genomic constitutions were tested against Foc race 1 (VCG 0124). In total, 19 genotypes (AA Unique-6, BB type-2, AAA Unique-1, AAA Cavendish-1, AAB Mysore-3, AAB Pome-1, AAB Plantain-4 and AAAB-1) were found to be immune; eight genotypes (AA Unique-1, BB type-3, AAA Cavendish-1, AAB Mysore-1, AAB Unique-1, AAB Plantain-1) were highly resistant; and nine genotypes (AA Unique-1, AAA Cavendish-3, AAB Silk-1, AAB Pome-4) were resistant. The genotypes that are resistant to the virulent Foc race 1 (VCG 0124) strain can be exploited directly for commercialization and/or in breeding programs to develop resistant hybrids.

Fusarium wilt caused by Fusarium oxysporum f.sp. cubense (Foc) is the most devastating disease affecting commercial and subsistence cultivation of banana (Musa spp.) worldwide. Generally, the Cavendish bananas are resistant to Foc race 1 that destroyed cv. 'Gros Michel' (AAA) and susceptible to tropical race 4 (TR4), which is causing severe epidemics in different banana-growing countries including India (Thangavelu et al. 2019). In 2019, a roving survey was conducted in major banana growing states of India such as Bihar, Uttar Pradesh, Gujarat and Tamil Nadu to assess the incidence of Fusarium wilt disease in Cavendish bananas and also to characterize the pathogens by different methods including Vegetative Compatibility Grouping (VCG) and molecular methods. The Fusarium wilt incidence in cv. Grand Naine (Cavendish group-AAA) was 6-65% in Bihar, 30-45% in Uttar Pradesh, 5-15% in Gujarat and 15- 21% in Tamil Nadu. For characterization, a total of 61 samples from the Fusarium wilt infected Cavendish bananas were collected and single spore culture of Foc was obtained. The morphological characterization revealed the presence of one to two oval- to kidney-shaped cells in false heads and sickle-shaped macroconidia and a foot-shaped basal cell. The pathogenicity was demonstrated by adopting randomized block design with five replications on cv. Grand Naine. The Koch's postulate was successfully completed by re-isolation of the inoculated Foc pathogen and characterization by PCR method. The VCG analysis carried out using nit-M testers of all known VCGs indicated the presence of VCG 0125 from the Foc samples collected from cv. Grand Naine grown in Uttar Pradesh (Siswabazar of Maharakanj district) and Tamil Nadu (Cumbum of Theni district), VCG 01220 from the Foc samples collected from cv. Grand Naine grown in Uttar Pradesh (Siswabazar of Maharakanj district) and Gujarat (Kamrej of Surat district,) and VCG 01213/16 from Foc samples collected from Uttar Pradesh (Siswabazar of Maharakanj district) and Bihar (Falka village of Katihar district) . The molecular confirmation of these VCGs 0125, and 01220 (Foc R1) isolates was carried out by PCR method using the primer set SIX6b_210_F and SIX6b_210_R (Carvalhais et al. 2019) for Foc R1, primer sets Foc TR4-F & Foc TR4 -R (Dita et al. 2010) for Foc TR4 and primer set Foc-1/Foc -2 (Lin et al. 2009) for Race 4. The results showed that only the primer set for Foc R1 has generated the expected amplicon size of 210 bp in the Foc isolates of VCG 0125 and 01220. Besides, the sequencing of Translation Elongation Factor (TEF) 1-α gene and BLAST searches in Genbank for the representative Foc isolates of VCG 0125 (Genbank no. MW 286800) showed 99.84% similarity to Foc R1 (KX365393.1) and Foc isolates of VCG 01220 (Genbank no. MW 286803) showed 99.69% similarity to Foc R1 (KX365413.1). Further, a phylogenetic analysis performed using the TEF1-α gene sequences showed that the Foc race 1 isolates (VCGs 0125 and 01220) from India were grouped with known Foc race 1 isolates from Tanzania and Australia. Based on the experimental results the study has confirmed the presence of VCGs 0125 and 01220 of Foc Race 1 in cv. Grand Naine in India. As these VCGs are most widely distributed and do not found to infect Cavendish bananas so far (Mostert et al. 2017), this report is very important from the quarantine and management perspectives. To the best of our knowledge, this is the first report of the occurrence of VCGs 0125 and 01220 of Foc Race 1 in cv. Grand Naine in India.

Rhizome rot or soft rot disease is one of the major problems in banana (Musa spp.) cultivation, as it causes germination failure and death of early stage plants. A roving survey conducted during 2017 to 2019 in the major banana growing states of India indicated a 5-30% incidence of rhizome rot in commercial cultivars. The symptoms observed were yellowing of leaves, necrotic drying with or without heart rot, and yellow or brown water soaked spots with dark brown margins in the rhizomes. Decay of tissues, cavity formation and brown ooze with foul smell, and toppling were also observed. To isolate bacteria, dissected diseased tissues were surface sterilized and plated on Crystal Violet Pectate (CVP) medium. Of 60 samples plated on CVP medium, three samples collected from cvs. NeyPoovan-AB (Karur, Tamil Nadu, 10°56'36.8"N;78°24'12.5"E), Grand Naine-AAA (Tiruchirappalli, Tamil Nadu, 10°47'26.1"N;78°34'14.8"E) and Thellachakkarakeli-AAA (East-Godavari, Andhra Pradesh, 16°51'32.1"N;81°46'08.4"E), did not yield any bacteria; however, when plated on nutrient agar, they produced whitish to dull white, mucoid, raised, round and translucent colonies, and three isolates were named as NPK-3-48, GTC-5 and 1-1B-3, respectively. Because these colonies were distinct from colonies obtained on CVP medium (which were analyzed and confirmed separately as Pectobaterium sp.) (Gokul et al. 2019), they were further characterized. Amplification of 16S rDNA genes of NPK-3-48, GTC-5 and 1-1B-3 isolates using universal primers (27F 5' - AGAGTTTGATCCTGGCTCAG - 3'; 1492 R 5' - GGTTACCTTGTTACGACTT - 3') and rpoB gene (Rosenblueth et al. 2004) was carried; the amplicons were sequenced and deposited in NCBI (Accessions MW036529-MW036531; MW497572-MW497574). Phylogenetic analysis of rpoB clearly showed that the isolates NPK-3-48, GTC-5, 1-1B-3 are Klebsiella variicola (Rosenblueth et al. 2004) Besides, biochemical tests also indicated that all three isolates were Gram negative, catalase positive, oxidase negative and able to utilize glucose, maltose and citrate (Ajayasree and Borkar 2018). Therefore, the above said morphological, molecular and biochemical analyses carried out indicated that NPK-3-48, GTC-5, 1-1B-3 are of K. variicola. Earlier, K. variicola causing soft rot has been reported on banana in China (Fan et al. 2016), plantain soft rot in Haiti (Fulton et al. 2020) and carrot soft rot in India (Chandrashekar et al. 2018). For pathogenicity tests, these three isolates were grown in nutrient broth for 48 h at 37±1°C and the cells were harvested by centrifugation. Five milliliters of the culture suspension (2×108 CFUmL-1) taken in a syringe was injected into rhizomes of three month old tissue cultured Grand Naine plants. Each bacterial isolate was injected into eight banana plants at soil level. Appropriate controls were maintained. Inoculated plants were maintained in a glasshouse at 32±2°C and after 30-35 days, rhizome rot symptoms appeared in all the three bacterial isolates inoculated plants but in none of the control plants. The Koch's postulates were proved by re-isolation and identification.To the best of our knowledge, this is the first report of K. variicola causing rhizome rot disease of banana in India.

Abstract Banana is affected by a wide number of diseases, of which, Fusarium wilt caused by Fusarium oxysporum f. sp. cubense ( Foc ) race 1 has played a major role in devastating Gros Michel banana plantations. Since 1960s, the pathogen Foc race 4 has threatened the survival and existence of the Cavendish group of bananas, which has necessitated detailed study on Fusarium wilt, the causal organism Foc , its biology, dispersal, pathogenicity, diversity and detection at a molecular level (especially in soils) and its management. The recently developed technique of transferring the gene encoding green fluorescent protein into Foc has assisted in visualizing and analysing the colonization and infection of banana plants by the pathogen. Studies on the pathogenicity secreted in xylem genes have helped in rapid detection of the pathogen in planta and techniques such as real-time fluorescence loop-mediated isothermal amplification assay have facilitated rapid and direct quantitative detection of Foc in soil. Several management practices, especially resistant varieties/transgenics and biological control methods are available for the effective management of this deadly disease. Strict quarantine procedures and reduction of Foc inoculum are the methods undertaken to limit the spread of the disease to other un-infected regions. This review summarizes the recent developments of Fusarium wilt in banana and its management.

Banana cultivation all over the world is currently facing an unimaginable threat from a newer much virulent strain of the Fusarium wilt pathogen termed Foc Tropical race 4 (Foc TR4). While the torment and recovery from the massive destruction of Gros Michel plantations by Fusarium oxysporum f.sp. cubense race 1 is still lingering around, the banana world faces another much aggressive strain tropical race 4. In this situation it is necessary to look upon and redesign the disease managing strategy keeping in mind the occurrences and losses endured till date due to this pathogen. It is so that the symptom of disease, biology and spread of the pathogen is quite similar to the previous strains, with differences prevailing only under genetic and protein expression levels. It is now a mandate to explore the molecular diversity of the pathogen for quick detection which in turn paves way for quicker pathogen exclusion and management. Even though there exists an umpteen number of the management practices, it is now the time to redesign the management structure and develop newer chemicals, biocontrol agents and resistant varieties to sustain the banana cultivation whose future is questioned by this pathogen. This review summarizes the recent developments in various aspects of Fusarium wilt in banana and its management.

Rhizome rot and pseudostem rot diseases of banana are caused by bacterial pathogens mainly of Pectobacterium carotovorum or Dickeya chrysanthemi individually or together and D. paradisiaca respectively. The bacterial rot diseases are reported to cause 40-70% incidence in severely infected fields and their occurrence has been reported worldwide. Diagnosis of the disease is based on presence of the characteristic symptoms such as brown rotting in rhizome and foul odor in advance stages in case of rhizome rot while wet brown rotting on pseudostem in initial stage followed by breakage of pseudostem from the point of wet rot in later stage for pseudostem wet rot. The pathogens are characterized by morphology, gram staining, biochemical and molecular bases. Management of the diseases is focused by use of chemicals, cultural practices and beneficial microbes.

Vascular wilts are the most important yield limiting diseases of vegetables and caused by both fungal and bacterial pathogens. The major wilt causing fungal pathogenic genera are Fusarium and Verticillium; while Ralstonia solanacearum is the bacterial wilt pathogen. These pathogens are a challenge to control because they often survive in soil for long periods and affect the crops throughout the year from across the plant families. The disease symptoms caused by each pathogenic genus are often creating confusions. For the effective plant disease management a thorough knowledge on symptoms caused by various pathogenic organisms, their detection and diagnostics techniques, mode of survival and infection, host range, and favorable conditions is needed. Similarly, to minimize the crop yield losses due to vascular wilt diseases, approaches like use of resistant varieties/cultivars, selection of suitable chemical fungicides/antibiotics, adopting different cultural practices and application of appropriate biocontrol agents, are to be included in the disease management practices. This review aims to provide comprehensive information about the vascular wilt diseases of vegetable crops, pathogen detection and disease management.