Fusarium wilt caused by Fusarium oxysporum f. sp. cubense (Foc), is the most lethal soil-borne fungal pathogen infecting bananas. Foc race 1 (R1) and 4 (R4) are the two most predominant races affecting the economically important Cavendish group of bananas in India. A total of seven vegetative compatibility groups (VCGs) from three pathogenic races were isolated during our field survey and were found to be highly virulent towards cv. Grande Naine. According to comparative genome analyses, these Indian Foc VCGs were diverse in genomic organization and effector gene profiles. As a result, false-positive results were obtained with currently available molecular markers. In this context, the study has been initiated to develop PCR-based molecular markers for the unambiguous identification of Indian Foc R1 and R4 isolates. Whole-genome sequences of Foc R1 (GCA_011316005.3), Foc TR4 (GCA_014282265.3), and Foc STR4 (GCA_016802205.1), as well as the reference genomes of Foc (ASM799451v1) and F. oxysporum f. sp. lycopersici (Fol; ASM14995v2), were aligned to identify unique variable regions among the Foc races. Using putative chromosome and predicted gene comparison, race-specific unique Foc virulence genes were identified. The putative lineage-specific identified genes encoding products secreted in xylem (SIX) that may be necessary for disease development in the banana. An in silico analysis was performed and primers were designed from a region where sequences were dissimilar with other races to develop a specific marker for Foc R1, R4, TR4, and STR4. These race-specific markers allowed target amplification in the characterized highly virulent Foc isolates, and did not show any cross-amplification to any other Foc races, VCGs or banana pathogens, Fusarium species, and non-pathogenic Fusarium oxysporum isolates. The study demonstrated that the molecular markers developed for all the three Foc races of India could detect the pathogen in planta and up to 0.025 pg µL−1 DNA levels. Thus, the markers developed in this study are novel and could potentially be useful for the accurate diagnosis and detection of the Indian Foc races which are important for the effective management of the disease.

Aim: This study aimed to investigate the impact of M. salsuginis TNMB03 biotization on tissue culture banana cv. Grande Naine plantlets growth and survival under greenhouse and open environmental condition (exposed to direct sunlight). Methodology: Banana plantlets were transferred from culture flasks to protray and maintained under the greenhouse and open environmental condition for 30 days with or without M. salsuginis TNMB03 treatment. After 30 days, plant growth parameters like pseudostem height, girth, number of leaves, leaf area, fresh and dry biomass, root parameters, plantlet survival, chlorophyll a and b, total chlorophyll, carotenoids and soluble protein and Methylobacterium population in upper and lower surface of leaf, as well as endophytic population were assessed. Results: This study showed that the plantlets biotized with M. salsuginis TNMB03 had better acclimatization response under both the experimental condition than that of uninoculated plantlets. Positive influence on the survival and growth of M. salsuginis TNMB03 biotized plantlets was observed when transferred directly to greenhouse and open environmental condition. Inoculation of M. salsuginis TNMB03 increased the plant height, girth and number of leaves, root length, lateral root and biomass in comparison to the uninoculated plantlets in greenhouse and open environment. Uninoculated plantlets kept under open environment had lower chlorophyll content and sun scorching damages compared to M. salsuginis TNMB03 inoculated plants, which had dark green leaves and increased chlorophyll content. Interpretation: This study shows a new potential technique of using M. salsuginis TNMB03 in tissue culture plantlets, which can help in enhancing the growth of plantlets transferred from culture vessel to greenhouse or open environmental condition without undergoing the routine acclimatization procedure.

Fusarium wilt is caused by the fungus Fusarium oxysporum f. sp. cubense (Foc) and is the most serious disease affecting bananas (Musa spp.). The fungus is classified into Foc race 1 (R1), Foc race 2, and Foc race 4 based on host specificity. As the rate of spread and the ranges of the devastation of the Foc races exceed the centre of the banana’s origin, even in non-targeted cultivars, there is a possibility of variation in virulence-associated genes. Therefore, the present study investigates the genome assembly of Foc races that infect the Cavendish (AAA) banana group in India, specifically those of the vegetative compatibility group (VCG) 0124 (race 1), 0120 (subtropical race 4), and 01213/16 (tropical race 4). While comparing the general features of the genome sequences (e.g., RNAs, GO, SNPs, and InDels), the study also looked at transposable elements, phylogenetic relationships, and virulence-associated effector genes, and sought insights into race-specific molecular mechanisms of infection based on the presence of unique genes. The results of the analyses revealed variations in the organisation of genome assembly and virulence-associated genes, specifically secreted in xylem (SIX) genes, when compared to their respective reference genomes. The findings contributed to a better understanding of Indian Foc genomes, which will aid in the development of effective Fusarium wilt management techniques for various Foc VCGs in India and beyond.

Fusarium wilt, caused by the fungus Fusarium oxysporum f. sp. cubense, is the most serious pandemic disease of banana. In this study, we report the draft genome of F. oxysporum f. sp. cubense vegetative compatibility group (VCG) 01213/16 of strain tropical race 4 (TR4) that infects the Cavendish (AAA) group of banana collected from the subtropical region in India. The genome assembly of SFoc TR4 comprises 47,384,463 bp with 4,034 contigs and 15,508 protein-coding regions. Based on VCG analysis, the fungal isolate belongs to F. oxysporum f. sp. cubense TR4 but the genome sequence of SFoc TR4 shows differences in secreted-in-xylem (SIX) protein gene clusters (specifically, SIX8) in comparison with the reference genome of F. oxysporum f. sp. lycopersici and F. oxysporum f. sp. cubense TR4.

Fusarium oxysporum f. sp. cubense is one of the most destructive soilborne fungi causing Fusarium wilt disease in banana. Generally, F. oxysporum f. sp. cubense race 1 (R1) severely affects most of the banana varieties, except Cavendish banana (AAA). Here, we present the draft genome of an isolate of VCG 0124, a novel virulent R1 strain that severely affects the Cavendish group of banana isolated from the Theni district of Tamil Nadu, India. The genome assembly of R1 comprises 61,471,473 bp with 88 contigs and 18,377 protein-coding regions. The genome contains homologs of F. oxysporum f. sp. cubense race-specific secreted-in-xylem (SIX) genes SIX1, SIX5, SIX9, and SIX13. The absence of SIX4 and SIX6 and deletion of a peptide in SIX1 virulence factor genes in the R1 (VCG 0124) strain might be the contributing factor for strains infecting Cavendish banana in India.

Fusarium wilt caused by Fusarium oxysporum f.sp. cubense (Foc) is the most devastating disease affecting commercial and subsistence cultivation of banana (Musa spp.) worldwide. Generally, the Cavendish bananas are resistant to Foc race 1 that destroyed cv. 'Gros Michel' (AAA) and susceptible to tropical race 4 (TR4), which is causing severe epidemics in different banana-growing countries including India (Thangavelu et al. 2019). In 2019, a roving survey was conducted in major banana growing states of India such as Bihar, Uttar Pradesh, Gujarat and Tamil Nadu to assess the incidence of Fusarium wilt disease in Cavendish bananas and also to characterize the pathogens by different methods including Vegetative Compatibility Grouping (VCG) and molecular methods. The Fusarium wilt incidence in cv. Grand Naine (Cavendish group-AAA) was 6-65% in Bihar, 30-45% in Uttar Pradesh, 5-15% in Gujarat and 15- 21% in Tamil Nadu. For characterization, a total of 61 samples from the Fusarium wilt infected Cavendish bananas were collected and single spore culture of Foc was obtained. The morphological characterization revealed the presence of one to two oval- to kidney-shaped cells in false heads and sickle-shaped macroconidia and a foot-shaped basal cell. The pathogenicity was demonstrated by adopting randomized block design with five replications on cv. Grand Naine. The Koch's postulate was successfully completed by re-isolation of the inoculated Foc pathogen and characterization by PCR method. The VCG analysis carried out using nit-M testers of all known VCGs indicated the presence of VCG 0125 from the Foc samples collected from cv. Grand Naine grown in Uttar Pradesh (Siswabazar of Maharakanj district) and Tamil Nadu (Cumbum of Theni district), VCG 01220 from the Foc samples collected from cv. Grand Naine grown in Uttar Pradesh (Siswabazar of Maharakanj district) and Gujarat (Kamrej of Surat district,) and VCG 01213/16 from Foc samples collected from Uttar Pradesh (Siswabazar of Maharakanj district) and Bihar (Falka village of Katihar district) . The molecular confirmation of these VCGs 0125, and 01220 (Foc R1) isolates was carried out by PCR method using the primer set SIX6b_210_F and SIX6b_210_R (Carvalhais et al. 2019) for Foc R1, primer sets Foc TR4-F & Foc TR4 -R (Dita et al. 2010) for Foc TR4 and primer set Foc-1/Foc -2 (Lin et al. 2009) for Race 4. The results showed that only the primer set for Foc R1 has generated the expected amplicon size of 210 bp in the Foc isolates of VCG 0125 and 01220. Besides, the sequencing of Translation Elongation Factor (TEF) 1-α gene and BLAST searches in Genbank for the representative Foc isolates of VCG 0125 (Genbank no. MW 286800) showed 99.84% similarity to Foc R1 (KX365393.1) and Foc isolates of VCG 01220 (Genbank no. MW 286803) showed 99.69% similarity to Foc R1 (KX365413.1). Further, a phylogenetic analysis performed using the TEF1-α gene sequences showed that the Foc race 1 isolates (VCGs 0125 and 01220) from India were grouped with known Foc race 1 isolates from Tanzania and Australia. Based on the experimental results the study has confirmed the presence of VCGs 0125 and 01220 of Foc Race 1 in cv. Grand Naine in India. As these VCGs are most widely distributed and do not found to infect Cavendish bananas so far (Mostert et al. 2017), this report is very important from the quarantine and management perspectives. To the best of our knowledge, this is the first report of the occurrence of VCGs 0125 and 01220 of Foc Race 1 in cv. Grand Naine in India.

Rhizome rot or soft rot disease is one of the major problems in banana (Musa spp.) cultivation, as it causes germination failure and death of early stage plants. A roving survey conducted during 2017 to 2019 in the major banana growing states of India indicated a 5-30% incidence of rhizome rot in commercial cultivars. The symptoms observed were yellowing of leaves, necrotic drying with or without heart rot, and yellow or brown water soaked spots with dark brown margins in the rhizomes. Decay of tissues, cavity formation and brown ooze with foul smell, and toppling were also observed. To isolate bacteria, dissected diseased tissues were surface sterilized and plated on Crystal Violet Pectate (CVP) medium. Of 60 samples plated on CVP medium, three samples collected from cvs. NeyPoovan-AB (Karur, Tamil Nadu, 10°56'36.8"N;78°24'12.5"E), Grand Naine-AAA (Tiruchirappalli, Tamil Nadu, 10°47'26.1"N;78°34'14.8"E) and Thellachakkarakeli-AAA (East-Godavari, Andhra Pradesh, 16°51'32.1"N;81°46'08.4"E), did not yield any bacteria; however, when plated on nutrient agar, they produced whitish to dull white, mucoid, raised, round and translucent colonies, and three isolates were named as NPK-3-48, GTC-5 and 1-1B-3, respectively. Because these colonies were distinct from colonies obtained on CVP medium (which were analyzed and confirmed separately as Pectobaterium sp.) (Gokul et al. 2019), they were further characterized. Amplification of 16S rDNA genes of NPK-3-48, GTC-5 and 1-1B-3 isolates using universal primers (27F 5' - AGAGTTTGATCCTGGCTCAG - 3'; 1492 R 5' - GGTTACCTTGTTACGACTT - 3') and rpoB gene (Rosenblueth et al. 2004) was carried; the amplicons were sequenced and deposited in NCBI (Accessions MW036529-MW036531; MW497572-MW497574). Phylogenetic analysis of rpoB clearly showed that the isolates NPK-3-48, GTC-5, 1-1B-3 are Klebsiella variicola (Rosenblueth et al. 2004) Besides, biochemical tests also indicated that all three isolates were Gram negative, catalase positive, oxidase negative and able to utilize glucose, maltose and citrate (Ajayasree and Borkar 2018). Therefore, the above said morphological, molecular and biochemical analyses carried out indicated that NPK-3-48, GTC-5, 1-1B-3 are of K. variicola. Earlier, K. variicola causing soft rot has been reported on banana in China (Fan et al. 2016), plantain soft rot in Haiti (Fulton et al. 2020) and carrot soft rot in India (Chandrashekar et al. 2018). For pathogenicity tests, these three isolates were grown in nutrient broth for 48 h at 37±1°C and the cells were harvested by centrifugation. Five milliliters of the culture suspension (2×108 CFUmL-1) taken in a syringe was injected into rhizomes of three month old tissue cultured Grand Naine plants. Each bacterial isolate was injected into eight banana plants at soil level. Appropriate controls were maintained. Inoculated plants were maintained in a glasshouse at 32±2°C and after 30-35 days, rhizome rot symptoms appeared in all the three bacterial isolates inoculated plants but in none of the control plants. The Koch's postulates were proved by re-isolation and identification.To the best of our knowledge, this is the first report of K. variicola causing rhizome rot disease of banana in India.

Aims This study aimed at determining the distribution, colonization and growth promoting nature of Methylobacterium spp. in tissue culture banana plantlets. Methods and Results Leaf samples from different field grown banana cultivars were used for Methylobacterium spp., isolation. Metabolic profile and functional characterization for plant growth-promoting traits of the isolates were assessed. The isolates were confirmed using 16S rRNA gene sequencing analysis, which resulted in six distinct species of Methylobacterium namely M. radiotolerans, M. salsuginis, M. thiocyanatum, M. rhodesianum, M. rhodinum and M. populi. Methylobacterium spp. inoculation experiment was conducted under hydroponic system in tissue culture banana plantlets (germ free) with eight selected isolates. A significant increase in growth parameters of Methylobacterium treated plantlets compared to uninoculated control was observed. Methylobacterium salsuginis TNMB03-gfp29 was developed and colonization micrograph was obtained using confocal laser scanning microscopy (CLSM) and scanning electron microscopy in different parts of banana plantlets (root, stem and leaves). Conclusion Field grown banana plants found to harbour diverse endophytic Methylobacterium population. Our finding suggests that endophytic Methylobacterium species may provide significant plant growth promoting compounds/nutrients to the banana plants. The experimental results demonstrated the efficacy of Methylobacterium spp. as a potential bioinoculant and can be exploited as a phyllosphere and rhizosphere based bioinoculant for the initial establishment and growth of tissue culture banana plantlets. Significance and Impact of the Study This study extended our knowledge on the distribution of Methylobacterium spp. in banana plants and endophytic colonization nature of this particular genus in plants. In addition, efficient isolate (M. salsuginis TNMB03) identified in this study may be promoted as bio-inoculants for banana plants after field evaluation.

Numerous outbreaks of foodborne diseases through fresh agricultural produce urge research to assess the source of entry of pathogens to the produce that compromise microbiological safety. In the present investigation, the entry of shiga-like toxin-producing Escherichia coli O157:H7 in a fresh vegetable production system was assessed by microbiological and molecular approaches. Five major vegetables, viz., beetroot, cabbage, carrot, onion, parsley, and potato, being cultivated routinely in the Western Guats of South India (The Nilgiris), were assessed for the prevalence of E. coli O157:H7. The fresh produce, rhizosphere soil, and water resources were sampled and the total coliforms and E. coli counts were assessed by plate count method and the O157:H7 by polymerase chain reaction targeting shiga-like toxin gene (stx1). The results revealed that all the vegetables collected from the fields had high levels of total coliforms (3 log CFU per g) with high proportions of E. coli (1–2 log CFU per g). The prevalence of O157:H7 among the E. coli isolates in these vegetables ranged from 0 to 5.8%. However, the prevalence of O157:H7 in rhizosphere soil of these vegetables was relatively high (1.6 to 42.5%). The water used for irrigation and washing the produce (carrot) also showed the presence of O157:H7. The real-time quantitative PCR (qPCR)–based detection of stx1 revealed that the O157:H7 prevalence in these vegetables and their rhizosphere soil were in higher magnitude than the counts by culturable method. The rhizosphere soil and water samples had higher O157:H7 CFU equivalents than fresh produce. It is evident that the soil as well as the irrigation and process water got contaminated with feces, which are assumed to be the primary source and cause for the entry of O157:H7 to the fresh vegetable. Hence, good agronomical practices and good hygiene post-harvest practices have to be imposed in the vegetable production system to avoid the pathogen entry.

The occurrence and role of endophytic bacterial communities in banana under different field-grown conditions have not yet been explored. Hence, a survey was conducted in five different banana cultivars - Rasthali, Hill banana, Co1, Nattu Poovan and Red banana - for the assessment of bacterial endophytes grown in Tamil Nadu, Southern India. From 352 endophytes isolated, 17 were selected based on distinct morpho-physiological characters. The 17 selected isolates were grouped into eight different genera, which belong to the phyla Actinobacteria, Firmicutes and Proteobacteria, with remarkable differences in the bacterial compositions among the banana cultivars. Higher bacterial diversity was observed in Rasthali and Red banana when compared to Co1 and Nattu Poovan. Isolates exhibited at least one functional plant growth-promoting trait when tested for siderophore production and indole-3-acetic acid (IAA) synthesis. Representative isolates from eight different genera were further analyzed for plant-microbe interactions. A seedling inoculation experiment on tomato showed a significant effect on seed germination, seedling growth, vigor index, and biomass production compared to the uninoculated control. However, a comprehensive approach is needed to evaluate the full potential of bacterial endophytes to improve quality and yield in banana under field conditions.

A total of 26 endophytic Methylobacterium sp.strains were obtained from surface sterilized leaves of two banana cultivar (Robusta and Nattu poovan) and the strains were tested for its ability to fix atmospheric nitrogen, EPS and IAA production for promoting banana tree growth.The result of the present study demonstrated that endophytic population ranged from 4.03 and 4.14 log cfu per gram of leaf tissue.Among these four isolates were chosen based on colony morphology and their distinct pigmentation.All the selected four isolates were able to grow in nitrogen free methanol mineral salt medium.The synthesis of indole-3-acetic acid (IAA) in the presence of L-tryptophan was detected in all the isolates tested.The isolate FM2 (Methylobacterium sp.) produced the highest amount of IAA (13.01g ml -1 ) in medium supplemented with L-tryptophan and was able to synthesize IAA in the absence of L-tryptophan.The maximum amount of ASP and WSP was recorded in FM3 (21.73 µg ml -1 ) and FM1 (157.79 µg ml -1 ), respectively.They were tentatively identified at species level based on carbon utilization test.The classified strains were also screened for methanol dehydrogenase (mxaF gene sequencing) using specific primers and obtained 555 bp PCR product.So the Methylobacterium sp.strains analyzed here had a promising potential for developing as a plant growth promoting bacteria for sustainable agriculture.