Lebanon's diverse landscapes and rich ecological zones support a high diversity of insect species, many of which remain taxonomically unresolved. To address this knowledge gap, we conducted the first comprehensive DNA barcoding survey of Lebanese insect diversity. Specimens collected using Malaise traps deployed at four sites between 2019 and 2021 were analyzed for sequence variation in the 658 bp barcode region of the mitochondrial cytochrome c oxidase subunit I (COI) gene. The 58 123 insect specimens included representatives of 5747 Barcode Index Numbers (BINs), and 56% of them are unique to Lebanon. By integrating DNA barcoding with morphological taxonomy, we assigned each BIN to one of 20 insect orders and identified 1224 species. Most specimens (95%) belonged to five dominant orders: Diptera, Hymenoptera, Hemiptera, Coleoptera, and Lepidoptera. The high proportion of unique BINs suggests high endemism within Lebanon and the broader Levant region. By generating a foundational inventory for Lebanon's insect fauna, this study has provided baseline data critical for future biodiversity monitoring and conservation planning in the Eastern Mediterranean while also making a substantial contribution to the global DNA barcode reference library.

Species identification plays a paramount role in biodiversity assessment, ecological research, and fisheries management. The current work presents molecular-based identification of the Clupeidae fish family from the coastal waters of Pakistan, along with the first-ever record of the COI of Nematalosa arabica. Between 2019 and 2023, overall, 30 specimens belonging to the eight species were collected at two major fish landing facilities, Gwadar (Balochistan) and Karachi Fisheries Harbour (Karachi). The COI sequence analysis showed distinct intra- and interspecific genetic diversity, indicating the presence of a barcode gap among the analyzed taxa. Intraspecific genetic distances ranged from 0 to 1.53% among the individuals of Sardinella gibbosa, having the highest observed intraspecific divergence. Moreover, the highest interspecific divergence based on K2P distance was 25.4% between Tenualosa toli and Escualosa thoracata. Phylogenetic analysis grouped species based on their genetic relationships and was congruent with the taxonomic classification. Closely related species were grouped in well-supported sister clades, and morphologically similar species (e.g., T. toli and H. kelee) were well-resolved into separate clades. Eight haplotypes were identified in T. toli, suggesting possible regional haplotype structuring; however, due to limited and uneven sampling, these findings are preliminary and require validation with larger datasets. Overall, these findings confirm the use of COI-based DNA barcoding for species identification in Clupeidae and emphasize the need for broader geographic sampling and multi-locus studies for resolving population structure and evolutionary relationships.

Human lice can be classified into several mitochondrial clades with distinct geographic distributions, reflecting long-term coevolution with ancient hominids and possibly with human populations. Analysis of ancient lice DNA from archaeological human remains can provide insights into the geographic origins of these clades and the timing of their dispersal. This study analyzes the COI barcode region of lice recovered from the ~1500-year-old salt-preserved mummy (Salt Man 2) at the Chehrabad salt mine in Zanjan Province, Iran. The sequences were compared with those of recent lice from Iran and other regions, available in the GenBank database, to determine clade affiliation and possible historical relationships. Our phylogenetic analysis recovered the five recognized mitochondrial clades (A–E). Ancient lice clustered within clade A but displayed novel haplotypes. Recent nits from Gilan and Kurdistan provinces were grouped within clades A and B, the only clades reported in Iran. The most complete ancient sequence (MLICE005-18) showed close similarity to sequences from Iraq, Pakistan, Egypt, and Iran. These findings, along with future research, could help determine when ancient lice lineages were established or introduced into specific regions. They could also clarify whether they represent haplotypes that have since disappeared or a lineage that still exists in understudied human populations.

Species belonging to the Serranidae fish family exhibit an overlapping color pattern that may lead to misidentification in the field. Their color pattern varies from juveniles to adults. DNA barcoding of species Epinephelus bleekeri, Epinephelus erythrurus, Epinephelus epistictus, Epinephelus diacanthus, Epinephelus coioides, Epinephelus stoliczkae, Epinephelus latifasciatus, Epinephelus polylepis, Epinephelus aerolatus, Epinephelus morrhua, Epinephelus radiatus, and Cephalopholis formosa belonging to Serranidae fish family was done to substantiate existing knowledge based on taxonomic relationships. Samples were collected from fish landing facilities along the Pakistan coast. The 680 bp 5(y) region of COI was amplified with the help of universal primers. After successful amplification sequencing was done using Sanger's method. Genetic diversity was calculated using obtained sequences. The mean interspecific genetic distance of 0.1444 was significantly higher than the mean intraspecific distance of 0.0051. The barcode gap analysis depicted significant genetic divergence affirming the delineation of species. The haplotype network gave valuable insights into the isolated and connected populations. The phylogenetic tree delineated apparent clades for all grouper species. The species having bars (E. diacanthus and E. stoliczkae) were clustered under the same clade and species having dots like (E. bleekeri, E. polylepis, and Epienephelus areolatus) were clustered under separate clade. DNA barcoding of the Serranidae fish family was done for the first time in Pakistan. The findings from the present study emphasized the importance of genetic-based sustainable management of fisheries, aquaculture, and the formation of conservation strategies. (c) 2025 National Science Museum of Korea (NSMK) and Korea National Arboretum (KNA). Publishing services by Elsevier B.V. This is an open access article under the CC BY-NC-ND license (http:// creativecommons.org/licenses/by-nc-nd/4.0/).

Although 5–20% of global crop production is lost to arthropod damage, current biomonitoring programs are extremely limited. This study evaluates the feasibility of using metabarcoding to assess overall insect diversity and detect pest species in agricultural settings. It introduces a curated DNA barcode reference library for Canadian insects that are agricultural pests and applies it to metabarcoding data from the analysis of Malaise trap samples from two experimental farms in Southern Ontario. A total of 7707 arthropod species were collected across the two farms, and projections indicate that another 4000 await detection. These taxa included 231 registered pest species. The composition of the overall arthropod community composition was more heavily influenced by site location than crop type, but pest species composition was influenced by the crop. This study confirms that metabarcoding enables the evaluation of the species composition of arthropod communities in agroecosystems, allowing pest species to be tracked.

Begomoviruses are ssDNA viruses exclusively transmitted by whitefly Bemisia tabaci. The begomoviruses-whitefly complex is responsible for inflicting severe damage to the crops. Soybean crop, new to Pakistan, remains unexplored regarding the virus-vector complex therefore present study was aimed to identify and determine the genetic variability of begomoviruses infecting soybean crop along with the whitefly mitotype(s) involved in their transmission. Soybean plants displaying symptoms of begomoviruses infection were collected and total genomic DNA was extracted from both symptomatic leaves and viruliferous whiteflies. Diagnostic PCR was employed to detect begomoviruses followed by whole genome amplification of begomoviruses by rolling circle amplification technique. The RCA products were subsequently cloned and sequenced. The partial cytochrome oxidase subunit I (COI) gene of the whiteflies was amplified and directly sequenced in both orientations. The sequences were assembled using Geneious R10 software and BLAST analysis was conducted through online NCBI web portal. Similarity index matrix and phylogenetic trees were constructed using sequence demarcation tool (SDT), MEGA11 and MrBayes software packages. The results proved 98% similarity of begomovirus Multan isolate with Tomato Leaf Curl New Delhi virus (ToLCNDV). The COI gene sequence of Bemisia tabaci showed 99.9% similarity with mitotype Asia II-I found in Pakistan. The study confirmed the infection of ToLCNDV and Asia-II-I presence on soybean in Multan, Pakistan and would be useful in understanding begomoviruses-whitefly complexes in Soybean crop and Southern Punjab.

Plant-specific transcription factor (PSTFs) YABBY is one of the vital transcription factors that play a crucial role in abaxial organ development, carpel formation and abiotic stress. Although the Cucumber genome (Cucumis sativus) has been published, functional studies are still needed to understand cucumber. The cucumber genome was used in this study to identify YABBY gene family member by using a set of various bioinformatic tools. Eight YABBY gene family members were identified that were unevenly distributed on different chromosomes. Eight members of the YABBY gene family in cucumber were divided into five subgroups (FIL/YAB3), CRC, INO, YAB2, and YAB5 based on the published Arabidopsis YABBY gene classification. The structure of PSTF YABBY was seen to be conserved throughout the process of evolution through Motif analysis, Conserved Domain Analysis and Gene structure Intron Exon Display. PSTF YABBY has roles in wound healing, abiotic stress like cold, heat and drought stress, phytohormone responses and transcription initiation. CsYABBY4 was seen to be over-expressed under long day and heat stress conditions, implying its significant role in heat stress.

Although Pakistan has rich biodiversity, many groups are poorly known, particularly insects. To address this gap, we employed DNA barcoding to survey its insect diversity. Specimens obtained through diverse collecting methods at 1,858 sites across Pakistan from 2010–2019 were examined for sequence variation in the 658 bp barcode region of the cytochrome c oxidase 1 (COI) gene. Sequences from nearly 49,000 specimens were assigned to 6,590 Barcode Index Numbers (BINs), a proxy for species, and most (88%) also possessed a representative image on the Barcode of Life Data System (BOLD). By coupling morphological inspections with barcode matches on BOLD, every BIN was assigned to an order (19) and most (99.8%) were placed to a family (362). However, just 40% of the BINs were assigned to a genus (1,375) and 21% to a species (1,364). Five orders (Coleoptera, Diptera, Hemiptera, Hymenoptera, Lepidoptera) accounted for 92% of the specimens and BINs. More than half of the BINs (59%) are so far only known from Pakistan, but others have also been reported from Bangladesh (13%), India (12%), and China (8%). Representing the first DNA barcode survey of the insect fauna in any South Asian country, this study provides the foundation for a complete inventory of the insect fauna in Pakistan while also contributing to the global DNA barcode reference library.

Cucumber mosaic virus (CMV) is one of the most important plant viruses and a major threat to a wide range of hosts. Prevalence of CMV in Pakistan is alarming for vegetable production especially cucurbits. The present study was done to estimate the prevalence, distribution as well as coat protein base identification of this notorious virus. During 2015-16 incidence of CMV was recorded in cucumber field in the Pothwar region of Pakistan (Rawalpindi, Attock, Jhelum, Chakwal, and Islamabad). During survey 150 samples were collected and tested through DASELISA (Double Antibody Sandwiched Enzyme Linked Immunosorbent Assay). Results show that CMV prevails throughout the region. Maximum disease incidence was recorded in Rawalpindi (50%) followed by Chakwal (46%), Attock (43%), Islamabad (40%) and Jhelum (36%). Virus infectivity was assayed by indicator plants (Capsicum annuum, Cucumis sativus cv, Chenopodium amaranticolor, C. quinoa, Nicotiana tabacum, and Datura stramonium) through mechanical inoculation. Upon mechanical inoculation, plants show Chlorotic lesion, Necrotic lesion, Mosaic, Stunting, Spots. Coat protein (CP) gene-specific forward (CMVF-45) and reverse (CMVR-45) primer amplified 500bp fragments through Polymerase Chain Reaction (PCR).

Co-infection of Carrot red leaf virus (CtRLV), Carrot mottle virus (CMoV) and Carrot red leaf virus associated RNA (CtRLVaRNA) causes Carrot motley dwarf (CMD) disease. This study examined the capacity of the aphid Myzus persicae at transmitting viruses associated with CMD. M. persicae exposed to CMD-infected chervil plants transmitted CtRLV-, CMoV- and CtRLVaRNA to disease-free chervil, fennel, celery, carrot, cilantro, and parsley, as shown by RT-PCR using specific primers. Recipient plants developed typical CMD symptoms. Sequence analysis of the amplified virus genes showed high sequence diversity with corresponding sequences available in GenBank. This study expands on Cavariella aegopodii, the only previously recognized aphid vector of CMD-causing viruses.

The peptide -Hexatoxin-Hv1a (Hvt) is one of the most studied spider toxins. Its insecticidal potential has been reported against species belonging to the arthropod orders Lepidoptera, Diptera and Orthoptera. The gene encoding Hvt has been transformed into cotton and tobacco to protect the plants from damage by lepidopteran pests. This study evaluated the expression of the -HXTX-Hv1a gene in transgenic plants, and the toxicity of plant-expressed and purified Hvt on target lepidopteran insects and on several non-target species. Transgenic Bollgard II cotton plants, which produce Cry1Ac and Cry2Ab2 and purified Cry2Ab2 protein were included in the study as comparators. LC95 values of purified Hvt against Spodoptera littoralis and Heliothis virescens were 28.31 and 27.57g/ml of artificial diet, respectively. Larval mortality was 100% on Hvt-transgenic tobacco plants but not on Hvt-transgenic cotton, probably because of the significantly lower toxin expression level in the transgenic cotton line. Non-target studies were conducted with larvae of the predators Chrysoperla carnea and Coccinella septempunctata, adults of the aphid parasitoid Aphidius colemani, and adult workers of the honey bee, Apis mellifera. Even at 40g/ml, Hvt did not adversely affect the four non-target species. Purified Cry2Ab2 at 10g/ml also did not adversely affect any of the non-target species. Our results show that Hvt might be useful for developing insecticidal plant varieties to control pest Lepidoptera.

The present study was conducted to resolve conflicts in the identification of grasshopper species of the family Acrididae (Orthoptera) on the basis of morphology and DNA barcoding. Grasshoppers representing 26 species of the family Acrididae were collected from different habitats and host plants from Poonch division of Azad Jammu Kashmir, Pakistan. Specimens were identified taxonomically and DNA sequenced for the cytochrome c oxidase (COI) barcode region. Barcodes of 19 morphological species were successfully obtained and the sequence data was used to separate species by Neighbor-Joining cluster analysis. Barcode data successfully discriminated 18 species, while two: Patanga japonica (Bolivar, 1898) and P. succincta (Johannson, 1763) could not be distinguished since they shared the barcode sequence and clustered together on the Neighbor-Joining (NJ) tree. Morphologically, specimens of Shirakiacris shirakii (Bolívar, 1914) were identified as one species, but barcode data revealed that in addition to Shirakiacris shirakii (Bolívar, 1914) two other species of the genus Shirakiacris are present in the region. Similarly, on the basis of morphological characters two species were indentified in subfamily Catantopinae, Catantops erubescens (Walker, 1870) and Xenocatantops brachycerus (Willemse, 1932), but barcode data suggest the presence of an additional Catantops species in the region. These findings show the usefulness of barcode data in discriminating grasshopper species and indicate that such data can be reliably used for developing reference libraries for species identification via sequence matches.

Current study focused on expression profiling of locally bred Bt-cotton varieties through ELISA and were tested for their efficacy against survival of Helicoverpa armigera in control environment. The population dynamics of five sucking arthropods; whitefly, jassid, aphid, thrips and mites, along the growing season was also monitored and correlated with different meteorological factors. Expression levels of insecticidal protein Cry1Ab/c were found to vary significantly (P<0.05) among varieties and across different sampling dates. The highest mean expression was recorded in GN-31 and Sitara-008 and the lowest in FH-113 and MG-6 while across sampling dates the highest mean expression was recorded at 30 days after emergence (DAE) which decreased along the season with lowest mean at 120 DAE. A critical expression level of Cry1Ab/c in leaves was found at 770 +/- 25 ng g(-1), for 95% control of the target insect pests. Sucking pest population was found to be variable among both the cultivars and the sampling dates. A positive correlation was found between rain/humidity and sucking arthropods population in the sampled cotton plots. (C) 2014 Friends Science Publishers

Thrips-transmitted Iris yellow spot virus is an economically important viral pathogen of Allium crops worldwide. A global analysis of known IYSV nucleocapsid gene (N gene) sequences was carried out to determine the comparative population structure, spatial and temporal dynamics with reference to its genetic diversity and evolution. A total of 98 complete N gene sequences (including 8 sequences reported in this study) available in GenBank and reported from 23 countries were characterized by in-silico RFLP analysis. Based on RFLP, 94% of the isolates could be grouped into NL or BR types while the rest belonged to neither group. The relative proportion of NL and BR types was 46% and 48%, respectively. A temporal shift in the IYSV genotypes with a greater incremental incidence of IYSVBR was found over IYSVNL before 2005 compared to after 2005. The virus population had at least one evolutionarily significant recombination event, involving IYSVBR and IYSVNL. Codon substitution studies did not identify any significant differences among the genotypes of IYSV. However, N gene codons were minimally positively selected, moderately negatively selected denoting the action of purifying selection, thus rejecting the theory of neutral mutation in IYSV population. However, one codon position (139) was found to be positively selected in all the genotypes. Population selection statistics in the IYSVBR, IYSVNL genotypes and in the population as a whole also revealed the action of purifying selection or population expansion, whereas IYSVother displayed a decrease in population size. Genetic differentiation studies showed inherent differentiation and infrequent gene flow between IYSVBR and IYSVNL genotypes corroborating the geographical confinement of these genotypes. Taken together the study suggests that the observed diversity in IYSV population and temporal shift in IYSVBR genotype is attributable to genetic recombination, abundance of purifying selection, insignificant positive selection and population expansion. Restricted gene flow between the two major IYSV genotypes further emphasizes the role of genetic drift in modeling the population architecture, evolutionary lineage and epidemiology of IYSV.

Onion (Allium cepa L.) is an important vegetable crop in Pakistan. According to the Food and Agricultural Organization (FAO), Pakistan is the world's fifth largest onion producer. The area and production is 127.8 thousand hectares and 1.7 million tons, respectively, with a yield of 13.8 tons per hectare during 2012. The agro-ecological diversity in the country enables onion production almost year round. Iris yellow spot virus (IYSV; family Bunyaviridae, genus Tospovirus), transmitted principally by Thrips tabaci, is an economically important viral pathogen of bulb and seed onion crops in many onion-growing areas of the world (1,3). In Asia, IYSV has been reported in India and Sri Lanka (2,4). During March to May 2012, as part of a survey for tospoviruses in vegetables, symptoms suspected to be caused by IYSV were observed on bulb and seed onions grown in farmers' fields in Faisalabad, Nankana, Sheikhupura, and Sialkot districts of Punjab. Symptoms consisted of spindle-shaped, straw colored, irregular chlorotic lesions with occasional green islands on the leaves. Approximately 60% of the fields surveyed had about 30% of the plants with these symptoms. The presence of the virus was confirmed with an IYSV-specific ELISA kit (Bioreba). IYSV infection was verified by RT-PCR with primers IYSV-F (TAAAACAAACATTCAAACAA) and IYSV-R (CTCTTAAACACATTTAACAAGCA) as forward and reverse primers, respectively. Amplicons of approximately 1,100 bp were obtained from the symptomatic samples, but not from healthy and water controls. The amplicons were cloned and sequenced. The IYSV-Pakistan isolates (GenBank Accession Nos. KF171103, KF171104, and KF171105) had the highest nucleotide sequence identity of 99% with the corresponding region of an IYSV isolate from Chile (DQ150107). To our knowledge, this is the first report of IYSV infecting onion in Pakistan. The relatively widespread occurrence of IYSV underscores the need for systematic surveys to assess its incidence and impact on onion bulb and seed crops so that appropriate management tactics can be developed. References: (1) D. H. Gent et al. Plant Dis. 88:446, 2004. (2) B. Mandal et al. Plant Dis. 94:468, 2012. (3) H. R. Pappu et al. Virus Res. 141:219, 2009. (4) K. S. Ravi et al. Plant Pathol. 55:288, 2006.

During this taxonomical exploration, 2 mites species were recognized and pinpointed from hypopial stage in the genus Caloglyphus. Mites were distinguishable morphologically and the new taxa identified were Caloglyphus bradys and C. austerus. Compared with previously documented species by analyzing 25 taxonomical characters of 10 already known countrywide deutonymphs, and the new taxa showed sufficient dissimilarity to be classified these as separate species. A historical review of the genus completed with already existing species; and traditional description, illustration of main body characters, geographical distribution, host, comparison remarks, matrix showing similarities and differences, and percentage of resemblance for the new species are given. These are followed by a hypopial-based key for recognition of 12 known Caloglyphus species identified from countrywide locations together with discussion on faunal relationships of this pest.