IgA nephropathy (IgAN) and membranous nephropathy (MN) are common glomerulonephritis, the presence of which in the same patient– concurrent of IgAN and MN (cIgAN/MN) has been described occasionally. This study aims to show clinical-pathological features of cIgAN/MN and attempts to suggest underlying pathogenesis using disease-specific biomarkers and a genomics approach. This retrospective cohort study described the clinical and pathological data from 137 patients with cIgAN/MN diagnosed in Peking University First Hospital from 2005 to 2019. One hundred primary IgAN and 100 MN cases were randomly selected as disease controls between the same time interval. Moreover, disease-specific biomarkers and polygenic risk score models were conducted to reveal the underlying pathogenesis. The median age of the cIgAN/MN cases was 45-year-old, and 46% were women. Compared to IgAN, patients with cIgAN/MN had a higher level of 24-hour proteinuria excretion but lower microscopic hematuria. They had a lower median level of galactose-deficient IgA1 (Gd-IgA1, 4.00 versus 5.45 μg/ml, P=0.002) as well as the standardized genetic risk scores of developing IgAN (GRSs: 0.05 versus 0.68, P<0.001). Compared to MN, patients with cIgAN/MN had a lower proportion of nephrotic syndrome and a lower level of albumin-to-creatinine ratio. However, the 24-hour proteinuria levels, serum lipid profiles, proportion of hypertension, and pathology classification were similar. Patients with cIgAN/MN had lower levels of plasma autoantibodies against the M-type transmembrane phospholipase A2 receptor (PLA2R) (11.23 versus 36.59 U/ml, P=0.005). Intriguingly, there were no statistical differences in standardized GRSs of developing MN between them (2.77 versus 3.02, P=0.326). Compared to IgAN, cIgAN/MN may lean towards MN more according to clinical-pathological features, disease-specific biomarker levels, and disease-specific genetic risk scores.

C-C chemokine receptor 6 (CCR6) is a susceptibility gene of various immune-related diseases, which was suggested to be shared with immunoglobulin A nephropathy (IgAN). In this study, we aimed to identify the functional variants. First, we analyzed the associations of CCR6 common and rare variants detected by multi-platform chips with IgAN susceptibility using imputation and identified 68 significantly associated common variants located in the regulatory region. Among them, rs3093023 showed both statistical significance (rs3093023-A, odds ratio [OR] = 1.15, P = 2.00 × 10−2) and the expression quantitative trait loci (eQTL) effect (P = 1.45 × 10−3). It was independently replicated (rs3093023-A, OR = 1.18, P = 5.56 × 10−3) and the association was reinforced in the meta-analysis (rs3093023-A, OR = 1.17, P = 6.14 × 10−7). Although rs3093023 was in a strong linkage disequilibrium with the reported CCR6 functional variant dinucleotide polymorphism, CCR6DNP, the alleles of rs3093023 (G>A) rather than of CCR6DNP were shown differential nuclear protein binding effect by electrophoretic mobility shift assay. The RegulomeDB and JASPAR databases predicted Pou2f1 as the potential transcription factor, which was negatively associated with CCR6 mRNA (r = −0.60, P = 3.94 × 10−9). At the mRNA level, the eQTL effect of CCR6 was validated (P = 4.39 × 10−2), and CCR6 was positively associated with the expression of CCR4 and IL-17A rather than that of CXCR3 and IFNG. At the protein level, a higher CCR6+ cell ratio was observed in a risk allele dose-dependent manner in lymphocytes (P = 3.57 × 10−2), CD3+ T cells (P = 4.54 × 10−2), and CD4+ T cells (P = 1.32 × 10−2), but not in CD8+ T cells. Clinical-pathological analysis showed that rs3093023 risk allele was significantly associated with diastolic blood pressure, serum creatinine, and high ratio of tubular atrophy/interstitial fibrosis. Overall, the rs3093023 was prioritized as the function variant in CCR6, which may contribute to IgAN susceptibility by regulating Th17 cells.

Disturbance in microbiota affects the mucosal immune response, and it is gradually recognized to be associated with the Immunoglobin A nephropathy (IgAN). This study aims to explore the potential roles of oral microbiota in disease pathogenesis. Saliva samples were collected from 31 patients with IgAN and 30 controls for 16S rRNA gene sequencing. The evenness, diversity, and composition of oral microbiota were analyzed. Moreover, sub-phenotype association analysis was conducted. Phylogenetic Investigation of Communities by Reconstruction of Unobserved States (PICRUSt) based on the Kyoto Encyclopedia of Genes and Genomes (KEGG) database was used to investigate microbiota functions. Compared to healthy controls, microbial diversity tended to decrease in IgAN, and the microbial profiles were remarkably distinguished. The relative abundance of Capnocytophaga and SR1_genera_incertae_sedis were enriched, whereas 17 genera, such as Rothia, were significantly reduced in IgAN. Variable importance in projection scores showed that 12 genera, including Capnocytophaga, Rothia, and Haemophilus, could discriminate between the two groups. In the sub-phenotype correlation analysis, the relative abundance of Capnocytophaga and Haemophilus was positively associated with levels of proteinuria and serum IgA, respectively. Further metabolic pathway analysis showed 7 predictive functional profiles, including glycosphingolipid biosynthesis, oxidative phosphorylation, and N-glycan biosynthesis were enriched in IgAN. In conclusion, disturbance in oral microbiota was observed to be associated with IgAN and its sub-phenotypes, which may shed novel insights into disease pathogenesis from a microbiome perspective.

BACKGROUND:Galactose-deficient IgA1 plays a key role in the pathogenesis of IgA nephropathy, the most common primary GN worldwide. Although serum levels of galactose-deficient IgA1 have a strong genetic component, the genetic link between this molecule and IgA nephropathy has not yet been clearly established. METHODS:To identify novel loci associated with galactose-deficient IgA1, we performed a quantitative genome-wide association study for serum galactose-deficient IgA1 levels, on the basis of two different genome-wide association study panels conducted in 1127 patients with IgA nephropathy. To test genetic associations with susceptibility to IgA nephropathy, we also enrolled 2352 patients with biopsy-diagnosed IgA nephropathy and 2632 healthy controls. Peripheral blood samples from 59 patients and 27 healthy controls were also collected for gene expression analysis. RESULTS:We discovered two loci, in C1GALT1 and GALNT12, that achieved genome-wide significance, explaining about 3.7% and 3.4% of variance in serum galactose-deficient IgA1 levels, respectively. We confirmed the previously reported association of C1GALT1 with serum galactose-deficient IgA1 levels, but with a different lead single-nucleotide polymorphism (rs10238682; β=0.26, P=1.20×10-9); the locus we identified at GALNT12 (rs7856182; β=0.73, P=2.38×10-9) was novel. Of more interest, we found that GALNT12 exhibits genetic interactions with C1GALT1 in both galactose-deficient IgA1 levels (P=1.40×10-2) and disease risk (P=6.55×10-3). GALNT12 mRNA expression in patients with IgA nephropathy was significantly lower compared with healthy controls. CONCLUSIONS:Our data identify GALNT12 as a novel gene associated with galactose-deficient IgA1 and suggest novel genetic interactions. These findings support a key role of genetically conferred dysregulation of galactose-deficient IgA1 in the development of IgA nephropathy.

Background Familial renal glucosuria (FRG) is characterized by persistent glucosuria without other impairments of tubular function in the presence of normal serum glucose. SGLT2, which is almost exclusively expressed in the kidney, accounts for most of the glucose reabsorption. Recently, some studies have confirmed that SLC5A2 mutations are responsible for the pathogenesis of familial renal glucosuria, but FRG cases are still rare. Furthermore, there are a few reports about splice-site mutations in previous studies, but the effect of these variants at the mRNA level has hardly been verified. Methods Ten patients were recruited in our renal division because of persistent glucosuria, and clinical data of the patients and their family members were recorded as much as possible. The entire coding region and adjacent intronic segments of SLC5A2 were sequenced in FRG patients and their relatives. Permanent growing lymphoblastoid cell lines from FRG patients were established to better preserve genetic information. Results A total of nine different mutations were identified: IVS1-16C > A, c.305C > T/p.(A102V), c.395G > A/p.(R132H), c.736C > T/p.(P246S), c.886(−10_-31)delGCAAGCGGGCAGCTGAACGCCC, c.1152_1163delGGTCATGCTGGC/p.(Val385_Ala388del), c.1222G > T/p.(D408Y), c.1496G > A/p.(R499H) and c.1540C > T/p.(P514S); two novel mutations in SLC5A2 , c.1222G > T/p.(D408Y) and c.1496G > A/p.(R499H), were identified in the Chinese FRG pedigrees. Ten individuals with heterozygous or compound heterozygous variants had glucosuria in the range of 3.1 to 37.6 g/d. Conclusion We screened ten additional Chinese FRG pedigrees for mutations in the SLC5A2 gene and found nine mutations, including two novel mutations. Most variants were private, but IVS1-16C > A and c.886(−10_-31) del may be high frequency splice-site mutations that could be preferentially screened when variants cannot be found in the SLC5A2 exon. Furthermore, we successfully established a permanent growing lymphoblastoid cell line from patients with FRG, which could facilitate further studies of the SLC5A2 gene. The current study provides a valuable clue for further research on the molecular mechanism of SGLT2.

Objective More recent studies suggested that defects in autophagy contribute to the pathogenesis of SLE, especially in adaptive immunity. Occurrence and progression of lupus nephritis (LN) is the end result of complex interactions between regulation of immune responses and pathological process by renal resident cells, but there is still a lot of missing information for an establishment on the role of autophagy in pathogenesis of LN and as a therapy target. Methods Systemic and organ-specific aetiologies of autophagy were first evaluated by autophagy protein quantification in tissue homogenates in MRL lpr/lpr lupus prone and female C57BL mice. Analysis of gene expression was also adopted in human blood and urine sediments. Then, some key mediators of the disease, including complement inactivated serum, IgG from patients with LN (IgG-LN) and interferon (IFN)-α were chosen to induce podocyte autophagy. Podocyte injuries including apoptosis, podocin derangement, albumin filtration and wound healing were monitored simultaneously with autophagy steady-state and flux. Results Elevated LC3B in kidney homogenates and increased autophagosomes in podocyte from MRL lpr/lpr were observed. In humans, mRNA levels of some key autophagy genes were increased in blood and urinary sediments, and podocyte autophagosomes were observed in renal biopsies from patients with LN. Complement inactivated serum, IgG-LN and IFN-α could induce podocyte autophagy in a time-dependent and dosage-dependent manner, and by reactive oxygen species production and mTORC1 inhibition, respectively. Autophagy inhibition aggravated podocyte damage whereas its inducer relieved the injury. Conclusion Podocyte autophagy is activated in lupus-prone mice and patients with lupus nephritis. Increased autophagy is cytoprotective against antibody and interferon-α induced podocyte injury.

Objective. Recent evidence from genetic, cell biology, and animal model studies has suggested a pivotal role of autophagy in mediating systemic lupus erythematosus (SLE). However, the genetic basis has not yet been thoroughly examined. Therefore, the aim of the present study was to identify additional susceptibility variants in autophagy-related genes along with their functional significance. Methods. First, we performed a gene family-based genetic association analysis in SLE patients with the use of ImmunoChip arrays, and then we selected the most strongly associated polymorphisms for replication in additional cohorts. To identify regulatory clues, we analyzed publicly available blood expression quantitative trait locus data and Encyclopedia of DNA Elements data on transcription factor binding sites and cell typespecific differential expression. Functional effects were tested by luciferase reporter assays, electrophoretic mobility shift assays, and differential gene expression assays. Results. In 14,474 samples, we observed that the rare Chinese variant rs933717T was associated with susceptibility to SLE (0.11% in cases versus 0.87% in controls; P = 2.36 x 10(-10), odds ratio 0.13). The rs933717 risk allele C correlated with increased MAP1LC3B expression; increased MAP1LC3B messenger RNA was observed in SLE patients and in lupus-prone mice. In reporter gene constructs, the risk allele increased luciferase activity up to 2.7-3.8-fold in both HEK 293T and Jurkat cell lines, and the binding of HEK 293T and Jurkat cell nuclear extracts to the risk allele was also increased. Conclusion. We observed a likely genetic association between light chain 3B, a widely used marker for autophagy, and susceptibility to SLE.

BACKGROUND:In immunoglobulin A nephropathy (IgAN), complement activation occurs in both the systemic circulation and in situ (glomerular). A recent IgAN-genome-wide association study (GWAS) identified 1q32 as an IgAN susceptible locus that contained the complement regulatory protein coding gene complement factor H (CFH). Here, we explored the combined genetic effects of coding and noncoding variants in CFH, rs6677604 and rs800292 on complement activation in IgAN.METHODS:In total, 1,194 IgAN patients and 900 healthy controls who were the same as the Beijing Discovery Cohort in our recent IgAN-GWAS were recruited. The genotyping information of rs800292 and rs6677604 were extracted from GWAS data, while the information regarding plasma C3 levels and mesangial C3 deposits were collected from medical records.RESULTS:We found both rs800292-GG and rs6677604-GG were risk genotypes for complement activation in IgAN patients, as represented by lower plasma C3 levels in IgAN patients with rs800292-GG and a higher intensity of glomerular C3 deposits in those with rs6677604-GG, respectively. Additionally, IgAN patients with 2 risk genotypes (rs800292-GG and rs6677604-GG) showed a higher degree of complement activation compared to those with no risk genotypes (rs800292-AA/AG and rs6677604-AA/AG), as represented by both lower plasma C3 levels and a higher intensity of glomerular C3 deposits. Moreover, when compared to rs800292 or rs6677604 alone, the combined genetic effects of rs800292 and rs6677604 showed a stronger association with IgAN susceptibility.CONCLUSIONS:Our findings suggested that both coding and noncoding variants in CFH acted synergistically to regulate the degree of complement activation and thereby contributed to IgAN susceptibility.

Autophagy is associated with various immune diseases, including systemic lupus erythematosus (SLE). Seven variants within autophagy-related genes previously reported to show top association signals by genome-wide association studies in immune diseases were selected for analysis. Initially, 510 SLE patients (631 controls) were enrolled in the study. An additional independent cohort of 511 SLE patients (687 controls) was included for replication. Polymorphism rs2638272 in LRRK2 gene showed significant association with susceptibility to SLE (P = 1.14 × 10-2) within the initial patient population. This was independently replicated (second patient cohort), and was reinforced with combination (P = 2.82 × 10-3). By combining multiple layers of regulatory effects, rs1491941 in high linkage disequilibrium with rs2638272 (r2 = 0.99) was regarded to have the strongest function in LRRK2. The rs1491941 protective A-allele exhibited an increase of nuclear protein binding, and an increase in LRRK2 transcription compared with G-allele. Furthermore, we observed increased transcription levels of LRRK2 in peripheral blood mononuclear cells from SLE patients compared with controls. In conclusion, we have identified a novel genetic association between the autophagy-related LRRK2 gene and susceptibility to SLE. By integrating layers of functional data, we derived the beneficial effect of autophagy on the pathogenesis of SLE.

Aberrant O-glycosylation of serum immunoglobulin A1 (IgA1) represents a heritable pathogenic defect in IgA nephropathy, the most common form of glomerulonephritis worldwide, but specific genetic factors involved in its determination are not known. We performed a quantitative GWAS for serum levels of galactose-deficient IgA1 (Gd-IgA1) in 2,633 subjects of European and East Asian ancestry and discovered two genome-wide significant loci, in C1GALT1 (rs13226913, P = 3.2 x 10-11) and C1GALT1C1 (rs5910940, P = 2.7 x 10-8). These genes encode molecular partners essential for enzymatic O-glycosylation of IgA1. We demonstrated that these two loci explain approximately 7% of variability in circulating Gd-IgA1 in Europeans, but only 2% in East Asians. Notably, the Gd-IgA1-increasing allele of rs13226913 is common in Europeans, but rare in East Asians. Moreover, rs13226913 represents a strong cis-eQTL for C1GALT1 that encodes the key enzyme responsible for the transfer of galactose to O-linked glycans on IgA1. By in vitro siRNA knock-down studies, we confirmed that mRNA levels of both C1GALT1 and C1GALT1C1 determine the rate of secretion of Gd-IgA1 in IgA1-producing cells. Our findings provide novel insights into the genetic regulation of O-glycosylation and are relevant not only to IgA nephropathy, but also to other complex traits associated with O-glycosylation defects, including inflammatory bowel disease, hematologic disease, and cancer.

An intronic variant at the complement factor H (CFH) gene on chromosome 1q32 (rs6677604) associates with risk of IgA nephropathy (IgAN), but the association signal has not been uniformly replicated in Han Chinese populations. We investigated whether the causal sequence variant resides in the CFH gene or the neighboring complement factor H-related 1 (CFHR1) gene and CFHR3, which harbor an 84-kb combined deletion (CFHR3,1Δ) in linkage disequilibrium with rs6677604. Imputation of 1000 Genomes Project data did not suggest new causal single-nucleotide variants within the CFH cluster. We next performed copy number analysis across the CFH locus in two independent Han Chinese case-control cohorts (combined n=3581). The CFHR3,1Δ and rs6677604-A alleles were rare (4.4% in patients and 7.1% in controls) and in strong linkage disequilibrium with each other (r2=0.95); of these alleles, CFHR3,1Δ associated more significantly with decreased risk of IgAN (odds ratio [OR], 0.56; 95% confidence interval [95% CI], 0.46 to 0.70; P=8.5 × 10-8 versus OR, 0.61; 95% CI, 0.50 to 0.75; P=1.6 × 10-6 for rs6677604-A). Moreover, CFHR3,1Δ explained all of the association signal at rs6677604 and remained significant after conditioning on rs6677604 genotype (P=0.01). Exploratory analyses of clinical and histopathologic parameters using the Oxford classification criteria revealed a suggestive association of CFHR3,1Δ with reduced tubulointerstitial injury (OR, 0.46; 95% CI, 0.25 to 0.79). These data indicate that dysregulated activity of the alternative complement pathway contributes to IgAN pathogenesis in both Asians and Europeans and implicate CFHR3,1Δ as the functional allele at this locus.

Known susceptibility loci together can only explain about 6–8% of the disease heritability of IgA nephropathy (IgAN), suggesting that there are still a large number of genetic variants remained to be discovered. We previously identified IgAN and systemic lupus erythematosus (SLE)/lupus nephritis (LN) shared many loci based on GWAS on Chinese populations. The more recent study with high-density genotyping of immune-related loci in individuals with Asian ancestry identified 10 new and 6 suggestive loci in SLE. In the current study, we thus included all the lead SNPs from these 16 loci reported, and firstly tested their associations in 1,248 patients with sporadic IgAN, 737 patients with LN and 1,187 controls. Significant associations identified in IgAN were replicated in additional 500 patients and 2372 controls. rs12022418 in RGS1 (p = 3.0 × 10−6) and rs7170151 in RASGRP1 (p = 1.9 × 10−5) showed novel associations in IgAN. Compared to SNPs that were in LD with them, the associated variants showed higher potential of regulatory features by affecting gene expression. And systemic evaluation of GWAS data supported the pleiotropic effects of RGS1 and RASGRP1 variants in mediating human complex diseases. In conclusion, novel risk loci shared between IgAN and SLE/LN were identified, which may shed new light to exploit the potential pathogenesis for those two diseases.

Objectives. The variant rs3828903 within MICB, a nonclassical MHC class I chain-related gene, was detected to contribute to systemic lupus erythematosus (SLE) in a Caucasian population. This study aimed to investigate the association in a northern Han Chinese population. Methods. We recruited 1077 SLE patients and 793 controls for analysis. rs3828903 was genotyped by TaqMan allele discrimination assay. Using the public databases, its functional annotations and gene differential expression analysis of MICB were evaluated. Results. Significant association between the allele G of rs3828903 and risk susceptibility to SLE was observed after adjusting for sex and age (P=1.87×10-2). In silico analyses predicted a higher affinity to transcription factors for allele G (risk) and cis-expression quantitative trait loci (cis-eQTL) effects of rs3828903 in multiple tissues (P ranging from 2.79×10-6 to 6.27×10-38). Furthermore, higher mRNA expressions of MICB were observed in B cells, monocytes, and renal biopsies from SLE patients compared to controls. Conclusion. An association between rs3828903 and susceptibility to SLE has been detected in a Chinese population. This together with the functional annotations of rs3828903 converts MICB into a main candidate in the pathogenesis of SLE.

Familial renal glucosuria (FRG) is characterized by persistent glucosuria in the presence of normal serum glucose concentrations, and the absence of other impairments of tubular function. Mutations in the sodium–glucose co-transporter 2 (SGLT2) gene (SLC5A2) are causative of FRG the long-term outcome of which is well know. In the search for potential new drug targets for SGLT2 inhibitors with which to treat the diabetes, expressional and functional studies of SGLT2 have been the focus of attention, but reports of these are rare. Furthermore, it is well known that the alleles in the C-terminal are very important for the expression and function in some genes. However, little is known about the effect of mutation in SLC5A2 C- terminal.

Low FCGR3 copy numbers (CNs) has been associated with susceptibility to several systemic autoimmune diseases. However, inconsistent associations were reported and errors caused by shaky methods were suggested to be the major causes. In large scale case control association studies, robust copy number determination method is thus warranted, which was the main focus of the current study. In the present study, FCGR3 CNs of 90 HapMap Asians were firstly checked using four assays including paralog ratio test combined with restriction enzyme digest variant ratio (PRT-REDVR), real-time quantitative (qPCR) using TaqMan assay, real-time qPCR using SYBR Green dye and short tenden repeat (STR). To improve the comparison precision reproductively, the results were compared with those from recently released sequencing data from 1000 genomes project as well as whole-genome tiling BAC array data. The tendencies of inconsistent samples by these methods were also characterized. Refined in-home TaqMan qPCR assay showed the highest correlation with array-CGH results (r = 0.726, p < 0.001) and the highest concordant rate with 1000 genome sequencing data (FCGR3A 91.76%, FCGR3B 85.88%, and FCGR3 81.18%). For samples with copy number variations, comprehensive analysis of multiple methods was required in order to improve detection accuracy. All these method were prone to detect copy number to be higher than that from direct sequencing. All the four PCR based CN determination methods (qPCR using TaqMan probes or SYBR Green, PRT, STR) were prone to higher estimation errors and thus may lead to artificial associations in large-scale case-control association studies. But different to previous reports, we observed that properly refined TaqMan qPCR assay was not inferior to or even more accurate than PRT when using sequencing data as the reference.

Familial renal glucosuria (FRG) is characterized by persistent glucosuria in the presence of normal serum glucose concentrations, while other impairments of tubular function are absent. Mutations in the sodium-glucose co-transporter 2 (SLC5A2) gene have been found to be responsible for FRG. However, direct evidence for the presence of SLC5A2 mutant in renal tissues is very rare. In previous studies, a non-sense mutation (c.1320 G>A:p.W440X) that would cause premature termination of the protein was found. However, the effects in the renal tissues were not reported. In the current study, a patient with FRG and a urinary glucose excretion rate of 8.3 g/day is described, for whom a novel missense mutation (c.1319G>A:p.W440X) was revealed by sequencing. Furthermore, in the immunofluorescence examination of a renal biopsy specimen, SLC5A2 was detected in the apical side of the proximal convoluted tubule, discontinuously decreased in comparison with that in normal and disease controls. The results imply that both wild-type SLC5A2 and mutant SLC5A2 with abnormal distribution were expressed in the renal tissues, and that the reduction of SLC5A2 expression and function were due to the c.1319G>A:p.W440X mutation. The current study provides valuable clues regarding the SLC5A2 molecule from genotype to phenotype in families affected by FRG.

Objectives. Numerous loci were identified to perturb gene expression in trans. As elevated ATG5 expression was observed in systemic lupus erythematosus (SLE), the study was conducted to analyze the genome-wide genetic regulatory mechanisms associated with ATG5 expression in a Chinese population with lupus nephritis (LN). Methods. The online expression quantitative trait loci database was searched for trans-expression single nucleotide polymorphisms (trans-eSNPs) of ATG5. Tagging trans-eSNPs were genotyped by a custom-made genotyping chip in 280 patients and 199 controls. For positive findings, clinical information and bioinformation analyses were performed. Results. Four trans-eSNPs were observed to be associated with susceptibility to LN (P < 0.05), including ANKRD50 rs17008504, AGA rs2271100, PAK7 rs6056923, and TET2 rs1391441, while seven other trans-eSNPs showed marginal significant associations (0.05 < P < 0.1). Correlations between the trans-eSNPs and ATG5 expression and different expression levels of ATG5 in SLE patients and controls were validated, and their regulatory effects were annotated. However, no significant associations were observed between different genotypes of trans-eSNPs and severity or outcome of the patients. Conclusion. Using the new systemic genetics approach, we identified 10 loci associated with susceptibility to LN potentially, which may be complementary to future pathway based genetic studies.

Objectives. Numerous loci were identified to perturb gene expression intrans. As elevatedATG5expression was observed in systemic lupus erythematosus (SLE), the study was conducted to analyze the genome-wide genetic regulatory mechanisms associated withATG5expression in a Chinese population with lupus nephritis (LN).Methods. The online expression quantitative trait loci database was searched fortrans-expression single nucleotide polymorphisms (trans-eSNPs) ofATG5. Taggingtrans-eSNPs were genotyped by a custom-made genotyping chip in 280 patients and 199 controls. For positive findings, clinical information and bioinformation analyses were performed.Results. Fourtrans-eSNPs were observed to be associated with susceptibility to LN (P< 0.05), including ANKRD50 rs17008504, AGA rs2271100, PAK7 rs6056923, and TET2 rs1391441, while seven othertrans-eSNPs showed marginal significant associations (0.05 <P< 0.1). Correlations between thetrans-eSNPs andATG5expression and different expression levels ofATG5in SLE patients and controls were validated, and their regulatory effects were annotated. However, no significant associations were observed between different genotypes oftrans-eSNPs and severity or outcome of the patients.Conclusion. Using the new systemic genetics approach, we identified 10 loci associated with susceptibility to LN potentially, which may be complementary to future pathway based genetic studies.

The effect of genetic markers associated with IgA nephropathy on risk of disease in sub-phenotype and progression is uncertain. Data from 2096 Chinese patients were used to create both un-weighted (uw) and weighted (w) genetic risk score (GRS). The association between GRS with disease susceptibility and clinical parameters were assessed. All nine selected single nucleotide polymorphisms (SNPs) were associated with susceptibility to IgAN. uwGRS and wGRS showed a similar fit in disease associations. With every 1-unit increase in the uwGRS, the disease risk increased by approximately 20%; whereas every one standard deviation increase in the wGRS, disease risk increased by approximately 40% ~ 60%. Association between rs3803800 and serum IgA was replicated and risk groups in GRSs were associated with increased IgA/IgA1 levels. uwGRS9 ≥ 16 was an independent predictor for end stage renal disease (ESRD) in IgAN, with a relative risk of 2.52 (p = 6.68 × 10−3). In conclusion, we observed that GRSs comprising nine SNPs identified in a GWAS of IgAN were strongly associated with susceptibility to IgAN. The high risk GRS9 group had a high risk of ESRD in follow-up.