Citation: Hellyer, T. P., McAuley, D. F., Walsh, T. S., Anderson, N. H., Conway Morris, A., Singh, S., Dark, P., Roy, A. I., Perkins, G. D., McMullan, R., Emerson, L. M. ORCID: 00000002-4250-5758, Blackwood, B., Wright, S. E., Kefala, K., O’Kane, C. M., Baudouin, S. V., Paterson, R. L., Rostron, A. J., Agus, A. M., Bannard-Smith, J., Robin, N. M., Welters, I. D., Bassford, C., Yates, B., Spencer, C., Laha, S. K., Hulme, J., Bonner, S., Linnett, V., Sonksen, J., Van Den Broeck, T., Boschman, G., Keenan, D. W. J., Scott, J., Allen, A. J., Phair, G., Parker, J., Bowett, S. A. and Simpson, A. J. (2020). More research is required to understand factors influencing antibiotic prescribing in complex conditions like suspected ventilatorassociated pneumonia. Annals of Translational Medicine, 8(13), 840.. doi: 10.21037/atm-203701

BACKGROUND:Ventilator-associated pneumonia is the most common intensive care unit (ICU)-acquired infection, yet accurate diagnosis remains difficult, leading to overuse of antibiotics. Low concentrations of IL-1β and IL-8 in bronchoalveolar lavage fluid have been validated as effective markers for exclusion of ventilator-associated pneumonia. The VAPrapid2 trial aimed to determine whether measurement of bronchoalveolar lavage fluid IL-1β and IL-8 could effectively and safely improve antibiotic stewardship in patients with clinically suspected ventilator-associated pneumonia.METHODS:VAPrapid2 was a multicentre, randomised controlled trial in patients admitted to 24 ICUs from 17 National Health Service hospital trusts across England, Scotland, and Northern Ireland. Patients were screened for eligibility and included if they were 18 years or older, intubated and mechanically ventilated for at least 48 h, and had suspected ventilator-associated pneumonia. Patients were randomly assigned (1:1) to biomarker-guided recommendation on antibiotics (intervention group) or routine use of antibiotics (control group) using a web-based randomisation service hosted by Newcastle Clinical Trials Unit. Patients were randomised using randomly permuted blocks of size four and six and stratified by site, with allocation concealment. Clinicians were masked to patient assignment for an initial period until biomarker results were reported. Bronchoalveolar lavage was done in all patients, with concentrations of IL-1β and IL-8 rapidly determined in bronchoalveolar lavage fluid from patients randomised to the biomarker-based antibiotic recommendation group. If concentrations were below a previously validated cutoff, clinicians were advised that ventilator-associated pneumonia was unlikely and to consider discontinuing antibiotics. Patients in the routine use of antibiotics group received antibiotics according to usual practice at sites. Microbiology was done on bronchoalveolar lavage fluid from all patients and ventilator-associated pneumonia was confirmed by at least 104 colony forming units per mL of bronchoalveolar lavage fluid. The primary outcome was the distribution of antibiotic-free days in the 7 days following bronchoalveolar lavage. Data were analysed on an intention-to-treat basis, with an additional per-protocol analysis that excluded patients randomly assigned to the intervention group who defaulted to routine use of antibiotics because of failure to return an adequate biomarker result. An embedded process evaluation assessed factors influencing trial adoption, recruitment, and decision making. This study is registered with ISRCTN, ISRCTN65937227, and ClinicalTrials.gov, NCT01972425.FINDINGS:Between Nov 6, 2013, and Sept 13, 2016, 360 patients were screened for inclusion in the study. 146 patients were ineligible, leaving 214 who were recruited to the study. Four patients were excluded before randomisation, meaning that 210 patients were randomly assigned to biomarker-guided recommendation on antibiotics (n=104) or routine use of antibiotics (n=106). One patient in the biomarker-guided recommendation group was withdrawn by the clinical team before bronchoscopy and so was excluded from the intention-to-treat analysis. We found no significant difference in the primary outcome of the distribution of antibiotic-free days in the 7 days following bronchoalveolar lavage in the intention-to-treat analysis (p=0·58). Bronchoalveolar lavage was associated with a small and transient increase in oxygen requirements. Established prescribing practices, reluctance for bronchoalveolar lavage, and dependence on a chain of trial-related procedures emerged as factors that impaired trial processes.INTERPRETATION:Antibiotic use remains high in patients with suspected ventilator-associated pneumonia. Antibiotic stewardship was not improved by a rapid, highly sensitive rule-out test. Prescribing culture, rather than poor test performance, might explain this absence of effect.FUNDING:UK Department of Health and the Wellcome Trust.

Although mitochondrial dysfunction plays a key role in the pathophysiology of acute kidney injury (AKI), the influence of mitochondrial genetic variability in this process remains unclear. We explored the association between the risk of post-cardiac bypass AKI and mitochondrial haplotype – inherited mitochondrial genomic variations of potentially functional significance. Our single-centre study recruited consecutive patients prior to surgery. Exclusions included stage 5 CKD, non-Caucasian race and subsequent off-pump surgery. Haplogroup analysis allowed characterisation of the study population using the common mutations and by phylogenetic supergroup (WXI and HV). Chi-square tests for association allowed the identification of potential predictors of AKI for use in logistic regression analysis. AKI occurred in 12.8% of the study population (n = 881; male 69.6%, non-diabetic 78.5%, median (interquartile range) age 68.0 (61.0–75.0) years). The haplogroup profile comprised H (42.7%), J (12.1%), T (10.9%), U (14.4%) and K (7.6%). Although the regression model was statistically significant (χ2 = 95.483, p < 0.0005), neither the phylogenetic supergroups nor any individual haplogroup was a significant contributor. We found no significant association between common European haplogroups and the risk of post-cardiac bypass AKI. However, given the major role of mitochondrial dysfunction in AKI, there is a need to replicate our findings in other cohorts and with other aetiologies of AKI.

Acute respiratory distress syndrome (ARDS) was first reported in a case series from Denver in 1967,1 and remains a major problem in the severely ill. This was highlighted by data from the recently published Large observational study to UNderstand the Global impact of Severe Acute respiratory FailurE (LUNG SAFE) trial, which recorded admissions over 4 weeks to 459 intensive care units (ICUs) in 50 countries and included 29 144 patients. In total, 3022 (10.4%) cases fulfilled ARDS criteria, including almost a quarter of those supported with invasive mechanical ventilation.2 ARDS was associated both with high mortality and prolonged length of stay. In addition, long-term follow-up studies of patients with ARDS indicate high long-term morbidity and decreased quality of life.3 There is therefore a real need to improve outcomes in ARDS. With this aim in mind, the Intensive Care Society (ICS)/Faculty of Intensive Care Medicine (FICM) guideline for the management of the ARDS in adults was published towards the end of 2018.4 The multidisciplinary Guideline Development Group used Grading of Recommendations Assessment, Development and Evaluation (GRADE) methodology.5 The group allocated selected outcomes as being either of critical (mortality up to 1 year, quality of life at 3 months) or high importance (quality of life at 6–12 months, length of ICU and hospital stay and treatment-associated harms). Ten interventions used in patients with ARDS were examined, based on existing recommendations and the experience of committee members, and informed by a survey of ICS members. The evidence-based findings are summarised in table 1. Two strong recommendations (using GRADE terminology) in favour of interventions and one strong recommendation against an intervention were made. Where mechanical ventilation is required, the use of low tidal volumes (<6 mL/kg ideal body weight) and airway pressures (plateau pressure <30 cmH2O) was recommended. For …

The Faculty of Intensive Care Medicine and Intensive Care Society Guideline Development Group have used GRADE methodology to make the following recommendations for the management of adult patients with acute respiratory distress syndrome (ARDS). The British Thoracic Society supports the recommendations in this guideline. Where mechanical ventilation is required, the use of low tidal volumes (<6 ml/kg ideal body weight) and airway pressures (plateau pressure <30 cmH2O) was recommended. For patients with moderate/severe ARDS (PF ratio<20 kPa), prone positioning was recommended for at least 12 hours per day. By contrast, high frequency oscillation was not recommended and it was suggested that inhaled nitric oxide is not used. The use of a conservative fluid management strategy was suggested for all patients, whereas mechanical ventilation with high positive end-expiratory pressure and the use of the neuromuscular blocking agent cisatracurium for 48 hours was suggested for patients with ARDS with ratio of arterial oxygen partial pressure to fractional inspired oxygen (PF) ratios less than or equal to 27 and 20 kPa, respectively. Extracorporeal membrane oxygenation was suggested as an adjunct to protective mechanical ventilation for patients with very severe ARDS. In the absence of adequate evidence, research recommendations were made for the use of corticosteroids and extracorporeal carbon dioxide removal.

BackgroundCritically ill patients with impaired neutrophil phagocytosis have significantly increased risk of nosocomial infection. Granulocyte-macrophage colony-stimulating factor (GM-CSF) improves phagocytosis by neutrophils ex vivo. This study tested the hypothesis that GM-CSF improves neutrophil phagocytosis in critically ill patients in whom phagocytosis is known to be impaired.MethodsThis was a multicentre, phase IIa randomised, placebo-controlled clinical trial. Using a personalised medicine approach, only critically ill patients with impaired neutrophil phagocytosis were included. Patients were randomised 1:1 to subcutaneous GM-CSF (3 μg/kg/day) or placebo, once daily for 4 days. The primary outcome measure was neutrophil phagocytosis 2 days after initiation of GM-CSF. Secondary outcomes included neutrophil phagocytosis over time, neutrophil functions other than phagocytosis, monocyte HLA-DR expression and safety.ResultsThirty-eight patients were recruited from five intensive care units (17 randomised to GM-CSF). Mean neutrophil phagocytosis at day 2 was 57.2% (SD 13.2%) in the GM-CSF group and 49.8% (13.4%) in the placebo group, p=0.73. The proportion of patients with neutrophil phagocytosis≥50% at day 2, and monocyte HLA-DR, appeared significantly higher in the GM-CSF group. Neutrophil functions other than phagocytosis did not appear significantly different between the groups. The most common adverse event associated with GM-CSF was fever.ConclusionsGM-CSF did not improve mean neutrophil phagocytosis at day 2, but was safe and appeared to increase the proportion of patients with adequate phagocytosis. The study suggests proof of principle for a pharmacological effect on neutrophil function in a subset of critically ill patients.

In order to limit the adverse effects of excessive inflammation, anti-inflammatory responses are stimulated at an early stage of an infection, but during sepsis these can lead to deactivation of immune cells including monocytes. In addition, there is emerging evidence that the up-regulation of mitochondrial quality control mechanisms, including mitochondrial biogenesis and mitophagy, is important during the recovery from sepsis and inflammation. We aimed to describe the relationship between the compensatory immune and mitochondrial responses that are triggered following exposure to an inflammatory stimulus in human monocytic cells. Incubation with lipopolysaccharide resulted in a change in the immune phenotype of THP-1 cells consistent with the induction of endotoxin tolerance, similar to that seen in deactivated septic monocytes. After exposure to LPS there was also early evidence of oxidative stress, which resolved in association with the induction of antioxidant defenses and the stimulation of mitochondrial degradation through mitophagy. This was compensated by a parallel up-regulation of mitochondrial biogenesis that resulted in an overall increase in mitochondrial respiratory activity. These observations improve our understanding of the normal homeostatic responses that limit the adverse cellular effects of unregulated inflammation, and which may become ineffective when an infection causes sepsis.

BACKGROUND:Early physical rehabilitation in the intensive care unit (ICU) has been shown to improve short-term clinical outcomes but long-term benefit has not been proven and the optimum intensity of rehabilitation is not known. METHODS:We conducted a randomised, parallel-group, allocation-concealed, assessor-blinded, controlled trial in patients who had received at least 48 hours of invasive or non-invasive ventilation. Participants were randomised in a 1:1 ratio, stratified by admitting ICU, admission type and level of independence. The intervention group had a target of 90 min physical rehabilitation per day, the control group a target of 30 min per day (both Monday to Friday). The primary outcome was the Physical Component Summary (PCS) measure of SF-36 at 6 months. RESULTS:We recruited 308 participants over 34 months: 150 assigned to the intervention and 158 to the control group. The intervention group received a median (IQR) of 161 (67-273) min of physical rehabilitation on ICU compared with 86 (31-139) min in the control group. At 6 months, 62 participants in the intervention group and 54 participants in the control group contributed primary outcome data. In the intervention group, 43 had died, 11 had withdrawn and 34 were lost to follow-up, while in the control group, 56 had died, 5 had withdrawn and 43 were lost to follow-up. There was no difference in the primary outcome at 6 months, mean (SD) PCS 37 (12.2) in the intervention group and 37 (11.3) in the control group. CONCLUSIONS:In this study, ICU-based physical rehabilitation did not appear to improve physical outcomes at 6 months compared with standard physical rehabilitation. TRIAL REGISTRATION NUMBER:ISRCTN 20436833.

Sepsis is a clinical syndrome with increasing incidence and mortality in which a systemic inflammatory response is triggered by infection. The clinical outcome of sepsis is primarily determined by the host response; in particular, monocyte deactivation plays a key role in sepsis-induced immune suppression and contributes to mortality.1Hall M.W. Knatz N.L. Vetterly C. Tomarello S. Wewers M.D. Volk H.D. et al.Immunoparalysis and nosocomial infection in children with multiple organ dysfunction syndrome.Intensive Care Med. 2011; 37: 525-532Crossref PubMed Scopus (212) Google Scholar, 2Monneret G. Lepape A. Voirin N. Bohé J. Venet F. Debard A.L. et al.Persisting low monocyte human leukocyte antigen-DR expression predicts mortality in septic shock.Intensive Care Med. 2006; 32: 1175-1183Crossref PubMed Scopus (379) Google Scholar While the underlying mechanisms of monocyte deactivation are not understood, there is increasing evidence that mitochondrial dysfunction contributes to the pathogenesis of sepsis. Monocytes from sepsis patients have impaired mitochondrial respiration and depletion of mitochondrial DNA (mtDNA). These findings correlate with the severity of the illness,3Belikova I. Lukaszewicz A.C. Faivre V. Damoisel C. Singer M. Payen D. Oxygen consumption of human peripheral blood mononuclear cells in severe human sepsis.Crit Care Med. 2007; 35: 2702-2708Crossref PubMed Scopus (100) Google Scholar, 4Garrabou G. Moren C. Lopez S. Tobias E. Cardellach F. Miro O. et al.The effects of sepsis on mitochondria.J Infect Dis. 2012; 205: 392-400Crossref PubMed Scopus (167) Google Scholar, 5Japiassú A.M. Santiago A.P. D'Avila J.C. Garcia-Souza L.F. Galina A. Castro Faria-Neto H.C. et al.Bioenergetic failure of human peripheral blood monocytes in patients with septic shock is mediated by reduced F1Fo adenosine-5′-triphosphate synthase activity.Crit Care Med. 2011; 39: 1056-1063Crossref PubMed Scopus (95) Google Scholar, 6Pyle A. Burn D.J. Gordon C. Swan C. Chinnery P.F. Baudouin S.V. Fall in circulating mononuclear cell mitochondrial DNA content in human sepsis.Intensive Care Med. 2010; 36: 956-962Crossref PubMed Scopus (54) Google Scholar but it is unclear whether the mitochondrial defects lead to the immune deactivation of blood monocytes or occur simply as a consequence of sepsis. To address this issue, we studied the effects of reducing mtDNA levels on immune function in THP-1 cells, a human monocyte cell line. Treatment of THP-1 cells with 50 ng/mL ethidium bromide for 8 weeks generated ρ0 cells lacking mtDNA (Fig 1, A) without adverse effects on cell viability (see Fig E1, A and the Methods in this article's Online Repository at www.jacionline.org). This completely suppressed mtDNA-encoded MT-CO1 protein levels and cytochrome c oxidase activity, without affecting nuclear-encoded SDHA expression or mitochondrial mass, measured by citrate synthase activity (Fig E1, B-D). The ρ0 cells had a blunted TNF-α response to treatment with 100 ng/mL LPS for 4 hours (Fig 1, B), consistent with monocyte deactivation. Repeating the experiments with short-interfering RNA ([siRNA], 30 nmol/L for 8 days) silencing the expression of mitochondrial transcription factor A (TFAM), a major component of the mitochondrial nucleoid that regulates mtDNA replication and gene expression (Fig 1, C), also suppressed mtDNA levels (Fig 1, D), reduced mitochondrial-encoded proteins and oxygen consumption (see Fig E2, C and D in this article's Online Repository at www.jacionline.org), and impaired the TNF-α response to LPS (Fig 1, E). While the TFAM siRNA-transfected THP-1 cells also had a reduced ability to phagocytose the gram-negative bacterium Escherichia coli (Fig E2, E), there was not a global downregulation of immunity as LPS-induced IL-8 production was unaltered (Fig 1, E). The effects of mtDNA depletion were partially reversed after removal of the siRNA (Fig 1, F-H and Fig E2, F-H). To determine the mechanism linking mtDNA depletion with impaired immune function, we performed whole transcriptome RNA-Seq before and after TFAM siRNA transfection (Fig 2, A and Fig E3 in the Online Repository at www.jacionline.org). There were 1389 differential expressed genes in TFAM siRNA-transfected THP-1 cells compared with control cells (Fig 2, A and B, see Data File E1 in this article's Online Repository at www.jacionline.org). Ingenuity Pathway Analysis (IPA) of the gene ontology showed suppression of key innate immune signaling pathways, including interferon and TREM1 signaling (Fig 2, C, and see Fig E3 and Table E1 in this article's Online Repository at www.jacionline.org). Following 4 hours' treatment with 100 ng/mL LPS, we observed a consistent upregulation of inflammatory genes (log fold-change [LogFC] > 1.5) (Fig E3, D). Gene ontology analysis showed that mtDNA depletion was associated with a significant downregulation of multiple signaling pathways involved in pathogen recognition following exposure to LPS (Fig E3, E-H, Table E2). Thus, the mtDNA depletion induced by TFAM siRNA blunts the immune response of THP-1 cells to LPS through known innate immune pathways. These findings were validated in independent experiments using quantitative RT-PCR; mtDNA depletion blunted the LPS-induced upregulation for key genes encoding cell surface receptors (TLR4, TREM1), proinflammatory cytokines (IL1B, TNF), interferon signaling molecules (IFIT1, IFITM1), and inflammatory mediators (MYD88, STAT1) (Fig 2, D-G). TLR-4 expression, measured by flow cytometry, was significantly decreased following mtDNA depletion (Fig 2, H), providing a potential explanation for the blunted immune response in THP-1 cells lacking mtDNA. IFN-γ has been shown to reverse immune deactivation in septic monocytes7Döcke W.D. Randow F. Syrbe U. Krausch D. Asadullah K. Reinke P. et al.Monocyte deactivation in septic patients: restoration by IFN-gamma treatment.Nat Med. 1997; 3: 678-681Crossref PubMed Scopus (966) Google Scholar and is a monocyte activator that stimulates TLR-4 expression through the interferon signaling pathways that are downregulated with mtDNA depletion. Treating mtDNA-depleted THP-1 cells with 100 ng/mL recombinant human IFN-γ in the final 24 hours of the 8-day siRNA transfection period had no adverse effects on THP-1 cell viability (see Fig E4, A in the Online Repository at www.jacionline.org), but increased both LPS-induced TNF-α release (Fig 2, I) and the capacity to phagocytose E coli (Fig 2, J and Fig E4, B). IFN-γ treatment increased cell surface expression of TLR-4 in all experimental conditions (Fig 2, K and Fig E4, C). Using 2 independent methods to induce mtDNA depletion, we show that mtDNA depletion can reversibly impair innate immune responses in THP-1 cells. In particular, we identify a significant inhibition of TNF-α production in response to LPS, thus reproducing the key phenotypic marker of immune deactivation in monocytes from patients with sepsis. The mtDNA depletion also inhibits interferon and pattern-recognition receptor-mediated signaling and decreased cell surface expression of TLR-4, changes that would fundamentally impair the responses of THP-1 cells to LPS and gram-negative bacteria. How can we explain the transcriptional changes we observed following mtDNA depletion? Mitochondrial abundance and mtDNA levels are tightly regulated in response to cellular energetic demands, and mtDNA depletion leads to a bioenergetic defect of OXPHOS and a reduction in ATP production. This could have several consequences. First, in cell lines from patients with rare inherited mtDNA mutations, the biochemical defect activates a retrograde signaling response from the mitochondria to the nucleus that alters the transcription of several genes known to be involved in immune activation. Linked to this there may be compensatory mitochondrial biogenesis, including the activation of peroxisome proliferator activated receptor (PPAR) signaling, similar to our observation in mtDNA-depleted THP-1 cells (Fig 2, C and Fig E3). Increased PPAR signaling has been associated with a shift to an anti-inflammatory phenotype in animal models of sepsis.8Rodríguez-Prados J.C. Través P.G. Cuenca J. Rico D. Aragones J. Martin-Sanz P. et al.Substrate fate in activated macrophages: a comparison between innate, classic, and alternative activation.J Immunol. 2010; 185: 605-614Crossref PubMed Scopus (662) Google Scholar Finally, the shift from oxidative to glycolytic metabolism in mtDNA-depleted THP-1 cells could produce changes in gene expression and immune phenotype. However, in macrophages, a shift to glycolytic metabolism has been associated with the adoption of a proinflammatory phenotype, with anti-inflammatory macrophages rather having enhanced OXPHOS activity.8Rodríguez-Prados J.C. Través P.G. Cuenca J. Rico D. Aragones J. Martin-Sanz P. et al.Substrate fate in activated macrophages: a comparison between innate, classic, and alternative activation.J Immunol. 2010; 185: 605-614Crossref PubMed Scopus (662) Google Scholar During severe sepsis, intense on-going mtDNA damage and mitochondrial dysfunction could overwhelm the capacity for mitochondrial biogenesis, leading to a gradual decline in mtDNA levels over time. Our data suggest that this may contribute to monocyte immune deactivation, which is associated with adverse clinical outcomes and could be reversed by IFN-γ. Our observations were made on a transformed human monocyte line and focused on TLR-4 specific mechanisms. If confirmed in human monocytes this would provide new opportunities to treat sepsis. THP-1 cells (TIB-202; ATCC, Manassas, Va) were maintained at a concentration of <1 × 106 cells/mL in RPMI 1640 medium supplemented with 10% FCS (subsequently termed growth medium) and contamination with mycoplasma was periodically excluded. Cell viability was determined by exclusion of 0.4% trypan blue (Sigma-Aldrich, St Louis, Mo), propidium iodide or 7-aminoactinomycin-D. All reagents were obtained from Thermo Fisher Scientific unless otherwise stated. THP-1 cells were incubated in RPMI 1640 medium supplemented with 50 ng/mL ethidium bromide, 110 μg/mL sodium pyruvate, 50 μg/mL uridine, 2 mmol/L L-glutamine, and 10% FCS (all final concentrations) for 8 weeks. THP-1 cells were transfected with Silencer Select TFAM siRNA (s14001, sense—GAAGAGAUAAGCAGAUUUAtt, antisense—UAAAUCUGCUUAUCUCUUCtt) or Silencer Select Negative Control siRNA number 1 (Thermo Fisher Scientific, Waltham, Mass) using the Lipofectamine RNAiMAX transfection reagent (Invitrogen, Thermo Fisher Scientific) and following the manufacturers' protocols. The transfection was repeated every 48 hours for 8 days. The effect of IFN-γ was determined by treating THP-1 cells with 100 ng/mL recombinant human IFN-γ (R&D Systems, Minneapolis, Minn) for the final 24 hours of the 8 day siRNA transfection. We seeded 2.5 × 105 THP-1 cells in 500 μL growth medium per well onto a 24-well plate (Grenier Bio-One, Monroe, NC) and incubated for 4 hours at 37°C ± 100 ng/mL LPS from E coli O26:B6 (Sigma-Aldrich). Subsequently, the release of TNF-α and IL-8 in supernatant samples was measured by ELISA using Novex Human Antibody Pair kits (Invitrogen) and following the manufacturer's protocol. Serum-opsonized fluorescein-labelled E coli K-12 strain were incubated with THP-1 cells at a multiplicity of infection of 10:1 for 1 hour at 37°C. After washing and quenching extracellular fluorescence through the addition of 0.1% trypan blue, the proportion of cells internalizing bacteria was then measured using the FACSCanto II flow cytometer (BD Biosciences, San Jose, Calif). DNA was extracted from cell pellets using the DNeasy blood and tissue kit (Qiagen, Hilden, Germany). The relative mtDNA copy number was determined by comparing the level of the mtDNA-encoded MT-ND1 gene (primers: F—ACGCCATAAAACTCTTCACCAAAG, R—GGGTTCATAGTAGAAGAGCGATGG) to that of the nuclear reference gene B2M (primers: F—CACTGAAAAAGATGAGTATGCC, R—AACATTCCCTGACAATCCC) by quantitative RT-PCR using the SYBR Green technique and the MyiQ PCR machine (both BioRad Laboratories, Hercules, Calif).E1Payne B.A. Wilson I.J. Hateley C.A. Horvath R. Santibanez-Koref M. Samuels D.C. et al.Mitochondrial aging is accelerated by anti-retroviral therapy through the clonal expansion of mtDNA mutations.Nat Genet. 2011; 43: 806-810Crossref PubMed Scopus (175) Google Scholar THP-1 cells were lysed using a lysis buffer containing 1% Triton X and 1 mmol/L of the protease inhibitor phenylmethanesulfonyl fluoride (both Sigma-Aldrich) and the protein concentration in the lysates determined by Bradford assay. Equal amounts of protein were separated on the basis of size by SDS-PAGE, transferred onto polyvinylidene fluoride membranes and blotted with different antibodies. Signal intensity was assessed after addition of an enhanced chemiluminescent substrate using the MultiSpectral Imaging System (UVP, Upland, Calif). In addition to the antimouse Ig-HRP (0260) secondary antibody from Dako (Agilent, Santa Clara, Calif), the following mouse antihuman antibodies were used: β-actin (ab8226), MTCO1 (ab14705), and SDHA (ab14715) from Abcam (Cambridge, UK) and TFAM (NBP1-71648) from Novus Biological (Littleton, Colo). Oxygen consumption for different aspects of mitochondrial respiration was measured using the Mito Stress kit and the Seahorse XF96e Extracellular Flux analyzer (both Seahorse Biosciences, Chicopee, Mass) as previously described.E2Liu T.F. Vachharajani V. Millet P. Bharadwaj M.S. Molina A.J. McCall C.E. Sequential actions of SIRT1-RELB-SIRT3 coordinate nuclear-mitochondrial communication during immunometabolic adaptation to acute inflammation and sepsis.J Biol Chem. 2015; 290: 396-408Crossref PubMed Scopus (103) Google Scholar In each well 0.8 × 105 THP-1 cells were seeded in 175 μL of an assay medium, consisting of modified Eagle medium supplemented with 11.1 mmol/L D-glucose and 2 mmol/L L-glutamine and adjusted to pH 7.0. Oxygen consumption rate (OCR) was measured at baseline and following the sequential addition of 1 μmol/L oligomycin (a complex V inhibitor), 0.5 μmol/L then 1 μmol/L carbonyl cyanide 4-(trifluoromethoxy) phenylhydrazone (an electron transport chain uncoupler), and finally 1 μmol/L rotenone (a complex III inhibitor) plus 1 μmol/L antimycin A (a complex I inhibitor). During each of the 4 stages of the assessment, the OCR was measured in 16 wells per condition at 3 different time points. All OCR data were normalized to the total protein per well, which was determined using the Bradford assay. RNA was extracted from pellets of 4 × 106 THP-1 cells using the RNeasy mini kit (Qiagen) and any residual DNA was then removed using the DNA-free DNase treatment kit (Thermo Fisher Scientific). The RNA samples with a RNA Integrity Number > 7 were sent to AROS Applied Biotechnology A/S (Ebersberg, Germany) where the RNA-Seq was carried out. The total RNA was converted into a library of template cDNA using the Illumina TruSeq Stranded Total RNA Sample Prep kit (San Diego, Calif) and this cDNA library was then sequenced using the Illumina HiSeq 2500 machine. Reads were aligned to the hg19 (human genome version 19, Genome Reference Consortium GRCh37.p13) reference genome, annotated and normalized to produce a read per kilobase per million mapped reads for each gene. Differential gene expression between samples and conditions was determined using DESeq2 software.E3Love M.I. Huber W. Anders S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2.Genome Biol. 2014; 15: 550Crossref PubMed Scopus (32318) Google Scholar, E4Anders S. Huber W. Differential expression analysis for sequence count data.Genome Biol. 2010; 11: R106Crossref PubMed Scopus (10306) Google Scholar The biological significance of the changes in gene expression on cellular processes and signaling pathways was investigated using IPA (Qiagen). In IPA the differential expression data were analyzed in the context of the Ingenuity Knowledge Base, a large curated database of published observations on mammalian biology, to identify the likely upstream causes and downstream effects of any changes in gene expression.E5Krämer A. Green J. Pollard Jr., J. Tugendreich S. Causal analysis approaches in Ingenuity Pathway Analysis.Bioinformatics. 2014; 30: 523-530Crossref PubMed Scopus (2765) Google Scholar Prior to the pathway analysis the normalized read per kilobase per million mapped data were filtered to include only genes that had >0.5 log-fold change between conditions and were significantly differentially expressed, as defined by a P-value adjusted for multiple comparisons using the Benjamini-Hochberg method <.05.E6Benjamini Y. Hochberg Y. Controlling the false discovery rate: a practical and powerful approach to multiple testing.J R Stat Soc Series B Stat Methodol. 1995; 57: 289-300Google Scholar The assessment of the effect of the changes in gene expression on canonical signaling pathways was also filtered to only include significantly altered pathways (adjusted P < .05) that differed from the mean in the control sample by >2 SD (z-score > ±2). Gene Ontology Consortium was used to perform the gene ontology analysis. Volcano plots and heat maps were produced using R statistical software (R Foundation, Vienna, Austria). Volcano plots were produced by plotting the adjusted P-values against the log2-fold change of the normalized gene counts, obtained from DESeq2. The most differentially expressed genes were obtained by ordering the absolute values of the log2-fold change in descending order. The normalized counts of the top 3000 genes were then used to produce heat maps. RNA was extracted from pellets of 4 × 106 THP-1 cells using the RNeasy mini kit and single-stranded cDNA was synthesized from this RNA using the High Capacity cDNA reverse transcription kit (Invitrogen). Following this the relative transcription of specific genes was determined by quantitative RT-PCR using the TaqMan Gene Expression Assay (Applied Biosystems) and the 7500 Fast Real Time PCR System (Thermo Fisher Scientific). The relative amount of cDNA for each specific target was determined by comparison with the control housekeeping gene ACTB using the difference in cycle threshold method. The fluorescence due to the labelling of cells with phycoerythrin-conjugated antihuman TLR-4 (CD284) antibodies (both from BioLegend, San Diego, Calif) was determined using the FACSCanto II flow cytometer. The signal intensity for each receptor was then calculated.E7Maecker H.T. Frey T. Nomura L.E. Trotter J. Selecting fluorochrome conjugates for maximum sensitivity.Cytometry A. 2004; 62: 169-173Crossref PubMed Scopus (160) Google Scholar All experiments were carried out on a minimum of 3 biological replicates; the number of replicates used to generate the data for a specific experiment is detailed in the legend of each figure. The Shapiro-Wilk test was used to determine the normality of the data. Normally distributed data are presented as means ± SD and were analyzed using an independent t-test or 1-way ANOVA with Dunnett post hoc analysis. Nonnormal data are presented as medians ± interquartile ranges and were analyzed using the Mann-Whitney U test or Kruskal-Wallis analysis of variance with Dunn post hoc analysis. The relationship between variables was assessed by linear regression and Pearson correlation coefficient. A P-value of less than .05 was defined as the threshold for statistical significance.Fig E2MtDNA depletion and impaired immune functions and subsequent recovery in THP-1 cells following transfection with TFAM siRNA. A-G, Transfection with TFAM siRNA. A, TFAM proteins levels relative to β-actin during titration of TFAM siRNA, showing optimal knockdown of TFAM protein after transfection of THP-1 cells with 30 nmol/L siRNA for 8 days. B, Cell viability. C, Cell proliferation. D, The levels of the MT-CO1 and SDHA proteins relative to β-actin. D, OCR for different aspects of mitochondrial respiration and respiratory profile. E, Phagocytosis of E coli. Recovery 8 days after removal of TFAM siRNA. F, Levels of the MT-CO1 and SDHA proteins relative to β-actin. G, Oxygen consumption for different aspects of mitochondrial respiration. H, Bacterial phagocytosis. All experiments were carried out on 3 to 4 independent biological replicates and are presented as means ± SD. **P < .01 and ***P < .001.View Large Image Figure ViewerDownload Hi-res image Download (PPT)Fig E3Canonical signaling pathways in mtDNA-depleted THP-1 cells with and without LPS treatment. THP-1 cells were incubated in growth medium or transfected with 30 nmol/L of negative or TFAM siRNA for 8 days. After a final incubation with 100 ng/mL LPS or medium for 4 hours, gene expression was assessed by RNA-Seq. A, Levels of transcripts for TFAM. B, Principal component analysis plot. C, The effect of transfection with TFAM siRNA on the interferon signaling pathway extracted from IPA (downregulated genes are highlighted in green and upregulated genes are highlighted in red). D, Volcano plot showing differentially expressed genes in each experimental condition following treatment with LPS. E, Volcano plot comparing the LPS response of TFAM siRNA-transfected cells to negative control siRNA transfected cells. (In the volcano plots, differentially expressed genes are highlighted in gray, genes with LogFC >1.5 are represented in red [upregulated] or blue [downregulated], while mitochondrial genes are highlighted in green. The size of the dots is proportional to the LogFC.) F, Gene Slim Ontology analysis carried out by Gene Ontology Consortium Fold Change enrichment for pathways with P < .05. G, IPA analysis of the canonical signaling pathways significantly affected by the differential expression of genes after treatment with LPS in TFAM siRNA-transfected THP-1 cells compared with negative siRNA-transfected cells. The data were filtered for Benjamini-Hochberg multiple testing correction P-value <.05 and z-score >±2. *P < .05 and ****P < .0001.View Large Image Figure ViewerDownload Hi-res image Download (PPT)Fig E4Treatment with IFN-γ increases TLR-4 expression and restores immune functions in THP-1 cells with mtDNA depletion following transfection with TFAM siRNA. THP-1 cells were treated with 100 ng/mL recombinant human IFN-γ or medium for the final 24 hours of an 8-day transfection with negative control or TFAM siRNA, or incubation with growth medium. A, Cell viability. B, Phagocytosis of E coli. C, Cell surface expression of TLR-4. All experiments were carried out on 3 independent biological replicates and are presented as means ± SD. ***P < .001.View Large Image Figure ViewerDownload Hi-res image Download (PPT)Table E1Details of the 5 signaling pathways most significantly affected by transfection with TFAM siRNAFunctionz-scoreP-valueGenes with altered expressionProportion of genes in pathwayUpregulatedDownregulatedInterferon signaling Cellular immune response Cytokine signaling−3.164.9 × 10−711/34—IFI35, IFNB1, IFIT1, IFITM1, IFITM2, IFITM3, IFIT3, IRF9, OAS1, STAT2, STAT1TREM1 signaling Cellular immune response Cytokine response−3.507.9 × 10−716/75MPOCCL3, CD83, CIITA, IL1B, ITGAX, MYD88, NLRC4, NLRP12, TLR1, TLR3, TLR6, TLR7, TNF, TREM1, TYROBPRole of pattern recognition receptors in recognition of bacteria and viruses Cellular immune response Pathogen-influenced signaling−3.745.5 × 10−620/127IL12AC3AR1, C5AR1, DDX58, EIF2AK2, IFIH1, IFNB1, IL1B, IRF7, MYD88, NLRC4, OAS1, OAS2, OAS3, PTX3, TLR1, TLR3, TLR6, TLR7, TNFToll-like receptor signaling Apoptosis Cellular immune response Humoral immune response Pathogen-influenced signaling−2.331.7 × 10−514/74IL12A, PPARAEIF2AK2, FOS, IL1B, IL1RN, MYD88, NFKBIA, TLR1, TLR3, TLR6, TLR7, TNF, TNFAIP3Acute phase response Cytokine signaling−2.675.2 × 10−317/169FTL, HMOX1, ORM1, ORM2, SOCS2A2M, AGT, CEBPB, FOS, IKBKE, IL1B, IL1RN, MYD88, NFKBIA, SERPINE1, SOCS3, TNF Open table in a new tab Table E2Details of the 5 pathways most significantly affected by the altered transcriptomic response to LPS following transfection with TFAM siRNAFunctionz-scoreP-valueGenes with altered expressionProportionUpregulatedDownregulatedTREM1 signaling Cellular immune response Cytokine response−4.156.3 × 10−921/75MPOCCL2, CCL3, CD40, CD83, CIITA, ICAM1, IL1B, ITGAX, MYD88, NLRC4, NLRP12, NOD2, TLR1, TLR3, TLR4, TLR6, TLR7, TNF, TREM1, TYROBPToll-like receptor signaling Apoptosis Cellular immune response Humoral immune response Pathogen-influenced signaling−2.132.8 × 10−820/74ELK1, IL12A, MAP3K14, PPARA, TRAF4EIF2AK2, FOS, IL1B, IL1RN, IRAK2, JUN, MYD88, NFKBIA, TLR1, TLR3, TLR4, TLR6, TLR7, TNF, TNFAIP3Interferon signaling Cellular immune response Cytokine signaling−3.327.2 × 10−712/34—IFI35, IFIT1, IFIT3, IFITM1, IFITM3, IFNB1, IRF9, MX1, OAS1, STAT2, STAT1, TAP1Activation of interferon regulatory factors by cytosolic pattern recognition receptors Cellular immune response−2.002.1 × 10−612/34—ADAR, CD40, DDX58, DHX58, IFIH1, IFIT2, IFNB1, IKBKE, IRF7, IRF9, ISG15, JUN, NFKBIA, STAT1, STAT2, TNFRole of pattern recognition receptors in recognition of bacteria and viruses Cellular immune response Pathogen-influenced signaling−3.745.5 × 10−620/127IL12AC3, C3AR1, C5AR1, DDX58, EIF2AK2, IFIH1, IFNB1, IL1B, IRF7, MYD88, NLRC4, NOD2, OAS1-3, PTX3, TLR1, TLR3, TLR4, TLR6, TLR7, TNF Open table in a new tab Download .xlsx (.1 MB) Help with xlsx files Data file E1

The Editor-in-Chief of Critical Care Medicine thanks the following physicians and healthcare professionals for contributing their time and expertise to the review of the manuscripts submitted to Critical Care Medicine from the previous year. Peer review is one of the most important cornerstones assuring the publication of the highest quality science and medical research. We sincerely appreciate the enormous amount of time and effort expended in 2011 by our outstanding reviewers.