TEN-ELEVEN-TRANSLOCATION-2 (TET2) and DNA-METHYLTRANSFERASE-3A (DNMT3A), both encoding proteins involved in regulating DNA methylation, are mutated in hematological malignancies affecting both myeloid and lymphoid lineages. We previously reported an association of TET2 and DNMT3A mutations in progenitors of patients with angioimmunoblastic T-cell lymphomas (AITL). Here, we report on the cooperative effect of Tet2 inactivation and DNMT3A mutation affecting arginine 882 (DNMT3A(R882H)) using a murine bone marrow transplantation assay. Five out of eighteen primary recipients developed hematological malignancies with one mouse developing an AITL-like disease, two mice presenting acute myeloid leukemia (AML)-like and two others T-cell acute lymphoblastic leukemia (T-ALL)-like diseases within 6 months following transplantation. Serial transplantations of DNMT3A(R882H) Tet2(-/-) progenitors led to a differentiation bias toward the T-cell compartment, eventually leading to AITL-like disease in 9/12 serially transplanted recipients. Expression profiling suggested that DNMT3A(R882H) Tet2(-/-) T-ALLs resemble those of NOTCH1 mutant. Methylation analysis of DNMT3A(R882H) Tet2(-/-) T-ALLs showed a global increase in DNA methylation affecting tumor suppressor genes and local hypomethylation affecting genes involved in the Notch pathway. Our data confirm the transformation potential of DNMT3A(R882H) Tet2(-/-) progenitors and represent the first cooperative model in mice involving Tet2 inactivation driving lymphoid malignancies.

Abstract Appropriate cancer care requires a thorough understanding of the natural history of the disease, including the cell of origin, the pattern of clonal evolution, and the functional consequences of the mutations. Using deep sequencing of flow-sorted cell populations from patients with chronic lymphocytic leukemia (CLL), we established the presence of acquired mutations in multipotent hematopoietic progenitors. Mutations affected known lymphoid oncogenes, including BRAF, NOTCH1, and SF3B1. NFKBIE and EGR2 mutations were observed at unexpectedly high frequencies, 10.7% and 8.3% of 168 advanced-stage patients, respectively. EGR2 mutations were associated with a shorter time to treatment and poor overall survival. Analyses of BRAF and EGR2 mutations suggest that they result in deregulation of B-cell receptor (BCR) intracellular signaling. Our data propose disruption of hematopoietic and early B-cell differentiation through the deregulation of pre-BCR signaling as a phenotypic outcome of CLL mutations and show that CLL develops from a pre-leukemic phase. Significance: The origin and pathogenic mechanisms of CLL are not fully understood. The current work indicates that CLL develops from pre-leukemic multipotent hematopoietic progenitors carrying somatic mutations. It advocates for abnormalities in early B-cell differentiation as a phenotypic convergence of the diverse acquired mutations observed in CLL. Cancer Discov; 4(9); 1088–1101. ©2014 AACR. See related commentary by Jiang and Elemento, p. 995 This article is highlighted in the In This Issue feature, p. 973

Genomic and expression analyses of human B-cell precursor acute lymphoblastic leukemia (BCP-ALL) have uncovered several oncogenic events that contribute to the transformation of B-cell progenitors.1 Besides BCR-ABL1, mutations and rearrangements detected in BCP-ALL predominantly affect genes coding for transcriptional regulators involved in the control of early hematopoietic differentiation, B-cell development or both. Activating mutations in the JAK2 gene that targets the R683 residue2, 3, 4 have been recently suggested to cooperate with the transcriptional activation of the gene coding for the cytokine receptor chain gene TSLPR/CRLF2.5 TSLPR codes for a cytokine receptor chain related to γc/IL2Rc. Both chains are able to interact with IL7R to constitute the receptor for IL7 (γc+IL7R) or TSLP (TSLPR+IL7R). Signaling from the IL7 receptor is known to involve JAK1 and JAK3 whereas intracellular signaling by the TSLP receptor is poorly characterized.6 In BCP-ALL, aberrant expression of TSLPR itself occurs through either a cryptic chromosomal translocation between the TSLPR locus (Xp22/Yp11) and the immunoglobulin heavy-chain locus (14q32) or through a deletion of chromosome X or Y pseudoautosomal sequences juxtaposing the P2RY8 gene to TSLPR.5 Sox5 upregulation through juxtaposition to the P2RY8 promoter has been previously reported in lymphoma.7

The transcription factor hypoxia inducible factor 1 (HIF1), an HIF1alpha-aryl hydrocarbon receptor nuclear translocator (ARNT) dimeric factor, is essential to the cellular response to hypoxia. We described a t(1;12)(q21;p13) chromosomal translocation in human acute myeloblastic leukemia that involves the translocated Ets leukemia (TEL/ETV6) and the ARNT genes and results in the expression of a TEL-ARNT fusion protein. Functional studies show that TEL-ARNT interacts with HIF1alpha and the complex binds to consensus hypoxia response element. In low oxygen tension conditions, the HIF1alpha/TEL-ARNT complex does not activate transcription but exerts a dominant-negative effect on normal HIF1 activity. Differentiation of normal human CD34+ progenitors cells along all the erythrocytic, megakaryocytic and granulocytic pathways was accelerated in low versus high oxygen tension conditions. Murine 32Dcl3 myeloid cells also show accelerated granulocytic differentiation in low oxygen tension in response to granulocyte colony-stimulating factor. Interestingly, stable expression of the TEL-ARNT in 32Dcl3 subclones resulted in impaired HIF1-mediated transcriptional response and inhibition of differentiation enhancement in hypoxic conditions. Taken together, our results underscore the role of oxygen tension in the modulation of normal hematopoietic differentiation, whose targeting can participate in human malignancies.

TO THE EDITOR The TEL gene (also known as ETV6), encoding a protein of the ETS transcription factor family, is involved in various rearrangements of human malignancies.1 The partner genes identified to date can be classified into two main subtypes according to the function of their encoded product: gene encoding proteins with tyrosine kinase activity and gene encoding transcription factors. The situation is less clear in several uncommon chromosome translocations involving TEL, which do not result in obvious fusion product.2 They might sometimes result in the transcriptional activation of genes located in the vicinity of the breakpoint on the translocated chromosome partner, or in the partial inactivation of TEL.3 In most of the fusion proteins including TEL, the TEL moiety provides a strong oligomerization domain (SAM domain) or transcriptional repression properties. The MN1–TEL fusion does not fit into this schema. The MN1 gene was at first identified from analysis of t(4;22)(p16;q11) in meningioma cells. MN1 encodes a transcription co-factor weakly expressed in various normal tissues.4, 5 The MN1–TEL fusion resulting from t(12;22)(p13;q11) is an uncommon example of fusion involving TEL, which occurs in acute leukemias and myelodysplastic syndromes and is expressed from the MN1 promoter. Two types of MN1–TEL fusion have been reported, MN1–TEL type I in which the SAM domain is conserved and type II in which the SAM domain is disrupted. The oligomerization properties of TEL are disrupted in both types of MN1–TEL fusion protein and they both possess strong transcriptional activation and transformation properties. We characterized the expression of TEL, MN1, and MN1–TEL in the human leukemic cell line UCSD/AML1 with t(12;22)(p13;q11), which is a suitable tool for the study of the MN1–TEL biological properties. We analyzed two cell lines with a t(12;22)(p13;q11): the UCSD/AML1 cell line, kindly provided by Dr HG Drexler (German Collection of Microorganisms and Cell cultures, Braunschweig) established by Oval et al from a patient with mixed acute leukemia in relapse.6 The karyotype was 45,XX,t(3;3)(q21;q26),-7,t(12;22)(p13;q11), as previously described. The MUTZ-3 cell line established from the cells of a patient with acute myelomonocytic leukemia, provided by Dr HG Drexler, has a complex karyotype including t(12;22)(p13;q11).7 FISH experiments were carried out using the following probes: for chromosome 12, YAC 936E2 covering TEL and cosmids encompassing the TEL locus 179A6, 50F4, 2G8, 184C4, 54D5, 148B6 (a kind gift of P Marynen, Leuven), and for chromosome 22, PAC dJ213J1 and BAC CTA-437G10 covering the MN1 locus. The YAC 936E, encompassing the TEL locus, hybridized to the normal 12, and to derivative chromosomes 12 and 22 in the two cell lines with t(12;22). In the UCSD/AML1 cell line, cosmids 179A6 and 50F4 hybridized to der(22) while cosmids 2G8 to 148B6 remained to der(12), showing that the breakpoint was located between TEL exons 2 and 3. In FISH experiments, the TEL copy on the unaffected chromosome 12 hybridized with all cosmids, suggesting the absence of gross abnormality. BAC 437G10 encompassing the MN1 gene hybridized to normal 22 and the two derivative chromosomes, suggesting that the MN1 gene was disrupted by the translocation (data not shown). In the MUTZ-3 cell line, the breakpoint on chromosome 12 has previously been localized within the sequences covered by cosmid 179A6 encompassing the TEL exon 1. TEL exons 3–5 were lost in the copy located to the untranslocated chromosome 12, as shown by FISH experiments with cosmid probes.2 BAC 437G10 hybridized to der(12) and PAC dJ213J1 gave a split signal on der(12) and der(22), suggesting that the breakpoint was centromeric to MN1 (data not shown). To check for MN1–TEL expression, RT-PCR experiments were carried out using primers corresponding to MN1 exon 1 (MN1-1; gccatgagcaccattga) and TEL exon 4 (TEL-4B; tagaattccagggtggaagaatg). A fragment of the expected size, 382 bp, was amplified from UCSD/AML1 material (Figure 1a) and confirmed by nucleotide sequence analyses to correspond to an MN1 exon 1–TEL exon 3 fusion (MN1–TEL type I transcript). In MUTZ-3 cell lines, no MN1–TEL transcript could be amplified as previously described.2 Expression of normal MN1 transcript was confirmed in both UCSD/AML1 and MUTZ-3 cell lines using MN1-specific primers (MN1-1 and MN1-3; gtcccaaatctgttggag; Figure 1a), but was not observed in the controls. To ensure protein expression, we carried out Western blot analyses with anti-CTEL and anti-MN1 (2F28) antibodies, using standard protocols. In UCSD/AML1 extract, the anti-MN1 antibody reacted strongly with a 200 kDa species, which was not observed in extracts from MUTZ-3 or RPMI8402 (Figure 1b). The size was consistent with the predicted size of the MN1–TEL protein and with previously published observations. Interestingly, wild-type MN1 proteins (predicted size: 136 kDa) were not observed in these cell extracts. The anti-TEL antibodies reacted with protein species corresponding to the size of normal TEL proteins (50 and 57 kDa) in UCSD/AML1 and RPMI8402 extracts (Figure 1b). A weak signal was also specifically observed in extracts from UCSD/AML1 that corresponded to the signal observed with anti-MN1 antibody in UCSD/AML1 extracts. This strongly suggests that a bona fide MN1–TEL fusion protein is detected in UCSD/AML1. As expected, no signal corresponding to the MN1–TEL protein was observed in extracts from MUTZ-3 or from RPMI 8402 cells. Subcellular location of MN1–TEL and TEL proteins was investigated by immunofluorescence experiments with anti-CTEL and anti-MN1 antibodies. Both antibodies generated a spotted fluorescence in the nuclei of cells from UCSD/AML1 (Figure 1d and f, respectively). No signal was observed using MN1 antibodies in the other cell lines tested (data not shown). Hematopoietic malignancies with t(12;22)(p13;q11) are uncommon, and, while only a few cases have been reported until now, various hematopoietic disorders were associated with the abnormality, such as acute myeloblastic leukemia, AML-M4, AML-M2, multilineage acute leukemia, and myelodysplastic syndrome. The MN1–TEL gene fusion, which is associated with the t(12;22), has been reported to encode a transcription factor with transforming activity. To characterize a cellular model suitable for biological studies, we analyzed the myeloid cell line UCSD/AML1, which bears this chromosomal translocation. An MN1–TEL fusion could be detected at the DNA, RNA, and protein levels. Expression of wild-type TEL proteins was observed, but wild-type MN1 proteins could not be detected in those cells. Comparison with the MUTZ-3 cell line shows that different consequences can result from apparently similar chromosome translocations. In MUTZ-3 cells, the t(12;22) translocation is associated with partial deletion of the untranslocated TEL copy, resulting in almost absence of the TEL protein.2 The reason why the fusion protein is easily detected whereas the wild-type MN1 protein remains under the threshold of detection could be due to various mechanisms, such as stabilization of the RNA or higher transcription levels of the fusion gene due to yet uncharacterized regulatory elements provided by the TEL moiety. Alternatively, stabilization or post-translational modification of the protein could be an important step in the leukemogenesis process, as suggested for the MLL-fusion protein.9 The leukemic cell line UCSD/AML1, which exhibits MN1–TEL fusion, is a new tool for analyzing the biological consequences of the MN1–TEL fusion. This work was partly supported by the INSERM, the Ligue Nationale contre le Cancer (LNCC), the Comité de Paris de la Ligue Nationale Contre le Cancer (LNCC-CP), and the Fondation pour la Recherche Médicale (FRM).

Most chromosomal translocations observed in T‐cell acute lymphoblastic leukemia (T‐ALL) often produce transcriptional activation of transcription factor oncogenes. Ectopic expression of the TLX3 (also known as HOX11L2 ) gene has been shown to be associated with a cryptic t(5;14)(q35;q32) translocation specific for a subtype of T‐ALL. Here we report several examples of variant and alternative translocations resulting in expression of TLX3 in T‐ALL, and we describe three of these translocations in detail. In particular, the CDK6 gene was rearranged in two t(5;7)(q35;q21) translocations. In two additional instances, fusion of the BCL11B (also known as CTIP2) and RANBP17/TLX3 loci were shown to result from subtle genomic insertion/deletion within these loci. This study further underscores that TLX3 expression in T‐ALL is strongly associated with the presence of genomic rearrangements. © 2004 Wiley‐Liss, Inc.

We previously reported the presence of circulating autoantibodies to hnRNPG protein in dogs with systemic lupus erythematosus (Soulard et al. 1993, 1994). These antibodies appeared to be specifically limited to German shepherd dog species. In the present report, we have analysed the nature of the hnRNPG epitopes responsible for autoantibody specificity. By using a set of 11 dog sera selected for their strong reactivity to hnRNPG protein, we have found that these sera had the ability to recognize two epitopes: (1) within a stretch of 33 amino acids located around the central part of protein, that is readily detected by immunoblotting; (2) a N-terminal conformation of the protein close to the RNA binding domain (RBD), that is revealed by immunoprecipitation. Our data strongly support the notion that the dog autoimmune response against hnRNPG protein is antigen-driven.

PURPOSE:To assess the folding and implantation of the single-piece EasAcryl 1 intraocular lens (IOL) and the maintenance of the tunnel structure and capsular bag stability after implantation. SETTING:S. Orsola Hospital Department of Pathophysiologic Optics, University of Bologna, Bologna, Italy. METHODS:This study comprised 300 cases of EasAcryl 1 IOL implantation. First, a 3.2 mm corneal incision was made according to preoperative astigmatism followed by a 5.5 mm +/- 0.3 (SD) capsulorhexis. After sutureless phacoemulsification using a venturi pump, the 6.0 mm optic, 11.0 mm diameter IOL was implanted using a hexagonal cartridge. The IOLs were implanted using a 2-step maneuver when the superior haptic was grasped with the forceps (first case) or a 1-step maneuver when only the Microsert injector was used. The cartridge was never pushed beyond the tunnel. The preoperative and postoperative incision size and the corneal surgically induced astigmatism were recorded. The IOL rotation was measured 30 +/- 5 days and 8 +/- 1 months postoperatively. RESULTS:No intraoperative complications occurred after the learning curve. No alteration in astigmatism was observed. The mean IOL rotation was 1.04 +/- 0.5 degrees at 30 +/- 5 days and 1.02 +/- 0.2 degrees at 8 +/- 1 months. CONCLUSIONS:The EasAcryl 1 was easily implantation through a 3.2 mm tunnel without altering the natural architecture. The unfolding of the IOL was well controlled, and the IOL remained well centered. A short learning curve is required.

FISH identified a cryptic t(5;14)(q35;q32) in T acute lymphoblastic leukemia (ALL), whereas it was not observed in B ALL samples. This translocation is present in five out of 23 (22%) children and adolescents with T ALL tested. RanBP17, a gene coding for a member of the importin β protein family, and Hox11Like2, an orphan homeobox gene were mapped close to the chromosome 5 breakpoints and CTIP2, which is highly expressed during normal T cell differentiation, was localized in the vicinity of the chromosome 14 breakpoints. The Hox11L2 gene was found to be transcriptionally activated as a result of the translocation, probably under the influence of CTIP2 transcriptional regulation elements. These data establish the t(5;14)(q35;q32) as a major abnormality, and Hox11 family member activation as an important pathway in T ALL leukemogenesis.

Inactivation of both the pRb (pRb-cyclin D1/cyclin-dependent kinase 4/6-p16) and p53 (p53-p21(WAF1)-p14(ARF)) pathways is thought to be essential for immortalization in vitro and malignant transformation in vivo. We identified different combinations of pRb and p53 pathway alterations in 12 invasive transitional cell carcinomas (TCCs) and addressed the functional significance of the different combinations observed. Results showed four combinations of alterations including -pRb/-p53 (ie., pRb inactivated in the pRb pathway and p53 inactivated in the p53 pathway; four TCCs), -p16/-p53 (four TCCs), -p16/-p21(WAF1) (one TCC), and -p16/ -p14(ARF) (two TCCs). These groups include two new combinations (ie., -p16/-p53 and -p16/-p21(WAF1)) not reported previously for TCCs. An alteration in the key components of the p53 pathway was not detected in one invasive TCC that had inactivated p16. Note that all four TCCs with inactivated pRb had mutant p53; thus, the combinations of -pRb/ -p21(WAF1) and -pRb/-p14(ARF) were not observed. Only two of eight TCCs with altered p16 had concomitant p14(ARF) loss, demonstrating that simultaneous inactivation of these two 9p21INK4a tumor suppressor genes is not obligatory. To determine the biological phenotypes of TCCs with different combinations of pRb and p53 pathway alterations, their downstream responses to gamma radiation were studied in vitro. As expected, none of eight TCCs with mutant p53 responded to gamma radiation by elevation of p53, p21(WAF1), or mdm2 or by cell cycle arrest. Only two of four TCCs with wild-type p53 and wild-type pRb (the combination of -p16/-p14(ARF)) showed normal downstream responses to gamma radiation and underwent cell cycle arrest. Two TCCs with wild-type pRb and wild-type p53 (the combination of -pl6/-p21(WAF1) and one TCC with -p16) failed to show cell cycle arrest in response to radiation. This was attributed to the absence of p21(WAF1) in one TCC. In summary, these data support a model of invasive bladder cancer pathogenesis in which both the pRb and p53 pathways are usually inactivated and the biology of the tumor is impacted by the mechanism of their inactivations.

The TEL gene is involved in several chromosomal abnormalities of human hematopoietic malignancies. The chromosome 12 breakpoints frequently lie within the fifth intron of the gene, particularly in the most frequent translocation involving TEL, the t(12;21)(p13;q22). In order to search for a peculiar mechanism involved in the genesis of these translocations, we have established the sequence of two t(12;21) and a t(9;12)(q24;p13) breakpoints. Our data do not reveal the involvement of VDJ recombinase activity or Alu sequences but favor the occurrence of staggered breaks and DNA repair activity in the genesis of these translocations.