Dissection of mouse embryo zona pellucida was performed using femtosecond IR laser pulses (wavelength 1028 nm, pulse duration 280 fs, pulse repetition rate 2.5 kHz). The purpose was to investigate (using optical microscopy) the dependence of the width D of the cut formed by the laser beam on the laser pulse energy E and beam velocity υ. It was shown for the first time that the same value of cut width can be obtained at different combinations of the aforementioned parameters. An analytical expression is proposed to describe the dependence of the width of a cut made on a zona pellucida, D(E, υ), at a specified laser pulse repetition rate: 2.5 kHz. The applicability limits are found for the D(E, υ) functional, which set a wide range of laser beam velocities (0.25 µm/s ≤ υ ≤ 100 µm/s) and energies: from minimum values, corresponding to the cut formation onset, to the optical breakdown of the aqueous medium: 115 nJ ≤ E ≤ 190 nJ. The results obtained allow one to estimate rapidly the width of the planned cut for any combination of the parameters E and υ at microsurgery of embryo zona pellucida in the framework of various assisted reproductive technologies.

The LEPR gene encodes a leptin hormone receptor, and its mutations are associated with morbid obesity, dysregulation of lipid metabolism, and fertility defects in humans. Spontaneous Lepr mutations have been described in rodents, and Lepr knockout animals have been generated, in particular, using the CRISPR/Cas9 system. Lipid metabolism in rodents significantly differs from that in humans or rabbits, and rabbits are therefore considered as the most relevant model of morbid obesity and lipid metabolism dysregulation in humans. LEPR knockout rabbits have not been reported so far. In this work a LEPR knockout rabbit was generated by introducing a deletion of the region around LEPR exon 10 using the CRISPR/Cas9 system. The body weight of the knockout rabbit was significantly higher than the average body weight of the wild type rabbits. CRISPR/Cas9-mediated generation of LEPR knockout rabbits will allow the development of a model of morbid obesity and endocrine defects due to leptin receptor mutations in humans.

The authors studied the dynamics of thinning of the zona pellucida (ZP) in mouse embryo as a result of laser-assisted hatching performed at the blastocyst stage. Mouse embryos previously subjected to a freeze–thaw cycle (cryo-embryos) were selected as model embryos. For ZP microsurgery, femtosecond laser pulses were used (radiation wavelength 512 nm, pulse duration 100 fs, intensity 2.5 TW/cm2). The thickness of the ZP was measured before microsurgery at the blastocyst stage ( E3.5, i.e., 3.5 days of embryonic development) and at the hatching stage ( E5). It was found that the ZP of control group embryos (cryo-embryos not subjected to laser exposure) thinned more strongly (from 6.6 (E3.5) to 4.9 µm (E5)) compared to experimental embryos after the laser-assisted hatching procedure (from 7.1 ( E3.5) to 6.4 µm (E5)). In both the first and second cases, changes in ZP thickness were statistically significant. The results were compared with data for “fresh” embryos not subjected to cryopreservation. There was no pronounced effect of ZP hardening in cryo-embryos compared to fresh embryos. The use of the laser-assisted hatching procedure for cryo-embryos made it possible to increase the probability of successful hatching compared to embryos in the control group from 38.5 to 52.5

The development of personalized medicine for genetic diseases requires preclinical testing in the appropriate animal models. GNAO1 encephalopathy is a severe neurodevelopmental disorder caused by heterozygous de novo mutations in the GNAO1 gene. GNAO1 c.607 G>A is one of the most common pathogenic variants, and the mutant protein Gαo-G203R likely adversely affects neuronal signaling. As an innovative approach, sequence-specific RNA-based therapeutics such as antisense oligonucleotides or effectors of RNA interference are potentially applicable for selective suppression of the mutant GNAO1 transcript. While in vitro validation can be performed in patient-derived cells, a humanized mouse model to rule out the safety of RNA therapeutics is currently lacking. In the present work, we employed CRISPR/Cas9 technology to introduce a single-base substitution into exon 6 of the Gnao1 to replace the murine Gly203-coding triplet (GGG) with the codon used in the human gene (GGA). We verified that genome-editing did not interfere with the Gnao1 mRNA or Gαo protein synthesis and did not alter localization of the protein in the brain structures. The analysis of blastocysts revealed the off-target activity of the CRISPR/Cas9 complexes; however, no modifications of the predicted off-target sites were detected in the founder mouse. Histological staining confirmed the absence of abnormal changes in the brain of genome-edited mice. The created mouse model with the “humanized” fragment of the endogenous Gnao1 is suitable to rule out unintended targeting of the wild-type allele by RNA therapeutics directed at lowering GNAO1 c.607 G>A transcripts.

Results of cutting the zona pellucida of mouse embryos in cryopreservation protocols by femtosecond laser pulses are presented. The study is aimed to find optimal parameters for laser assisted hatching procedure.

Results of cutting the zona pellucida of mouse embryos by infrared femtosecond laser pulses are compared with those for visible wavelength. The study is aimed to find optimal parameters for laser assisted hatching procedure.

Under conditions of lymphopenia, T lymphocytes proliferate and acquire a surface activation phenotype, which in many respects is similar to the phenotype of true memory T cells. We investigated the phenotypic features of the CD8+ T-cell population formed from donor lymphocytes after adoptive transfer of syngeneic splenocytes to sublethally irradiated mice. This population expresses markers CD44, CD122, CD5, CD49d and the chemokine receptor CXCR3. Thus, for the first time, the phenomenon of the formation of a population of T cells with signs of suppressive CD8+ T lymphocytes and true memory cells was demonstrated.

Both TCRα and TCRβ types of T-cell receptors contribute to antigen recognition. However, some TCRs have chain centricity, which means that either the α-chain or the β-chain dictates the peptide-MHC complex specificity. Most earlier reports investigated the role of well-studied β-chains in antigen recognition by TCRαβ. In a previous study, we identified TCRs specific to the H-2Kb molecule. In the present work, we generated transgenic mice carrying the α-chain of this TCR. We found that these transgenic mice rejected EL-4 tumor cells bearing alloantigen H-2Kb more effectively than wild-type mice and similarly to mice with established specific memory T cells. Moreover, we found that T cells transduced with this TCRα can inhibit EL-4 cell growth in vitro and in vivo. We also found that transgenic mice recruit fewer CD8 T cells into the peritoneal cavity at the peak of the immune response and had a significantly higher number of central memory CD8 T cells in the spleen of intact transgenic mice compared to intact wild-type control. These results indicate the ability of a single transgenic α-chain of the H-2Kb-specific TCR to determine specific recognition of the H-2Kb molecule by a repertoire of T lymphocytes and to rapidly reject H-2Kb-bearing lymphoma cells.

Cyclophilin A (CypA) is a multifunctional protein that exhibits an isomerase activity and exists in the intracellular and secretory forms. Secretory CypA promotes regeneration of the hematopoietic and the immune systems of an organism by stimulating stem cell migration from the bone marrow. New approaches based on CypA are currently being developed for the treatment of limb ischemia, neutralization of the side effects of Cyclosporine A (CsA) therapy, etc. However, the role of CypA in the antitumor immune response is still unexplored. In this work, we used the model experimental system of lymphoma EL-4 rejection in B10.D2(R101) mice and showed that recombinant human CypA (rhCypA) stimulates the antitumor immune response via early recruitment of granulocytes to the tumor cell localization site and rapid accumulation of effector T-killers

The technology of creating genetically modified animals (placental mammals) by microinjection into the pronucleus of a fertilized egg suggests, as one of the key stages, the transplantation of early embryos into female recipients. However, there is a wide range of opinions among researchers about the optimal number of embryos to be transferred to the female recipient. Thus, data on transplantation of 20–60 mouse embryos and from 2 to 6 goat embryos to one recipient are given in the methodological literature and experimental articles devoted to the method of creating genetically modified animals. Thus, the standard recommendation is the transfer of a much larger number of embryos than that which develops in animals of both species in physiological pregnancy. At the same time, technology of transplantation of bovine embryos (cattle) involves the transfer of one embryo, which is the physiological norm for this species of animals. Clinical protocols of assisted reproductive technologies for the transplantation of human embryos also recommend the transfer of one embryo, because transferring the number of embryos greater than in physiological pregnancy leads to increased risks. In our work, we analyze the results of experiments on obtaining genetically modified mice and goats and provide data indicating the need to revise the standard recommendations on the number of transferred embryos downward. We believe that the number of transferred embryos should not exceed the number of embryos characteristic for physiological pregnancy. Excess of the number of transplanted embryos leads to a pathological course of pregnancy and a significant decrease in overall performance.

A peripheral pool of T lymphocytes consists of several functionally distinct populations of CD8+ T cells. One of the major surface markers that allow to define different populations of T cells are CD44 and CD62L. Expression profile of these markers depends on the functional status of T lymphocyte. Naive CD8+ T cells express CD62L and do not express CD44 (CD62LhiCD44lo), clones of T cells activated during the primary immune response lose CD62L and express CD44 (CD62LloCD44hi). Central memory CD8+ T cells express both CD44 and CD62L (CD44hiCD62Lhi). However expression of activation markers not always correlate with an antigen experience of T cell. It is known, that in lymphopenic conditions peripheral T cells undergo homeostatic proliferation and acquire the memory like surface phenotype CD44hiCD62Lhi, but data about functional activity of these cells remain controversial. We studied relationship between surface expression of the markers CD44 and CD62L and functional properties of CD8+ T cells under lymphopenic conditions. We proved that surface expression of CD44 in not the only condition for T lymphocyte to acquire the functional properties of memory T-cells. It means that identification of CD8 + T-memory cells based solely on an expression profile of surface markers is not completely correct and requires confirmation by functional tests. Moreover, results of our research may become of practical importance for blood transfusion and bone marrow transplantation.

Introduction: Lesch-Nyhan syndrome is a clinical and laboratory disorder caused by X-linked disruption of the purine metabolism. The deletion in the HPRT1 gene leads to the disappearance of valine in the eighth position of the protein amino acid sequence. The disease occurs in males and is accompanied by an excess of uric acid, urate nephropathy and neurologic impairment. Objective of the Study: Generation of the new personalized genetic mouse model of Lesch-Nyhan syndrome for preclinical study of new approaches to the pharmacological and gene therapy Materials and Methods: For genomic editing, the sequence was synthesized the sequence of the matrix GACCGGTCCCGTCATGCCGACACGCAGTCCCAGCGTGGTGAGCCAAGGGGACTCCAGCAGAGCCCCACAG was synthesized. For the cultivation of viable mouse embryos after microinjection, KSOM media was used. Amplification and sequencing was performed by the standard methods. Results: A boy with not previously described hemizygous variant in the HPRT1 gene, was observed in our clinic. The mutation was the deletion of 8Val in the first exon of the HPRT1 gene. To introduce this mutation, we used the CRISPR-Cas9 genomic editing system. The genetic construct for microinjections included a mixture of the vector for the expression of Cas9 and sgRNA (px330), as well as the matrix for homologous recombination (ssODN), in a ratio of 1 part Cas9 to 3 parts of the ssODN matrix. Four of the 12 obtained animals were mosaic transgenes. One of 4 mice mated with a male from the hybrid strain CBA x C57BL/6, and descendants of F2 have already been received from this mating. Discussion: During the creation of HPRT1 genetically modified mice, we encountered certain difficulties. First, from 615 transplanted embryos, only 12 were able to complete full embryonic development. 9 recipients we observed abortions in the later stages. These data may indicate possible violations of embryonic development in animals carrying a mutant copy of the HPRT1 gene. Conclusion: In the current study, we present the results of the generation of a genetically modified mouse strain carrying a deletion in the HPRT1 gene. These mice can be effectively used for the preclinical testing of new drugs aimed at the treatment of Lesch-Nyhan syndrome.

Background. Wide use of glucocorticoids therapy for neoplasms, autoimmune diseases and allergies is associated with suppression of adaptive immunity that requires profound study of their immunoregulatory properties and immunotoxicity.Results. In this work, using our model of selective activation of mouse CD8+ memory cells in the mixed lymphocyte reaction (MLR) in vitro, we show for the first time that intraperitoneal injection of high dose hydrocortisone (2.5 mg per animal) allows to detect memory cells in the thymus of animals immunized with allogeneic tumor cells. Similar to memory cells from other lymphoid organs, hydrocortisone-resistant thymic lymphocytes from immune animals respond on allogeneic stimulators subjected to severe heat shock and are immunologically specific to immunizing alloantigen. Thus, cortisone-resistant thymocytes are partially or completely represented by memory cells. We also show here that memory responses of heterozygotes on TCR a-chain knock-out (genetically incapable to secondary rearrangement of TCR achains) are significantly enhanced as compared with the ones of wild type mice.Conclusion. These findings allows to suggest the hypothesis according to which memory T cell clones proliferating in primary immune response migrate into thymus providing necessary microenvironment for reexpression of recombinases. After editing of genes encoding TCR achains, such T lymphocytes can return to peripheral repertoire maintaining its wideness.

In wide number of approaches to treatment of cancer immunotherapy plays special role. This approach exploits capabilities of immune system to support genetic constancy of different cells and tissues of the organism. Immunotherapy is designed to induce tumor cell destruction by T-lymphocytes whose receptors can recognize peptides of mutant proteins complexed with the molecules of the major histocompatibility complex. In clinical practice T-lymphocytes can result in sustained and complete responses in patients whose cancers were resistant to available treatment options. Recent evidences suggest that efficiency of such therapy generally depends on metabolic properties of T-lymphocytes. A number of approaches allows modulate T-cell metabolism providing strategies to optimize activity of anti-tumor T-lymphocytes.

Findings in experimental oncology in beginning of last century and subsequent achievements of genetics of tissue compatibility resulted in divergence of transplantational immunology and oncoimmunology. However, central achievements of both scientific fields are based on unified phenomenon of interaction between T-cell receptor (TCR) and histocompatibility molecules. In this review we describe the history of ideas, achievements and unique experience of the team of the Laboratory of Regulatory Mechanisms in Immunity at Scientific Research Institute of Carcinogenesis, N.N. Blokhin Russian Cancer Research Center for all time of existence. This experience shows that efficiency of immunological defense including immunological surveillance are critically influenced by T-cell receptor repertoire. Transgenesis of individual chains of TCR is one of possible means to manage T-cell repertoire. Functional outcomes of transgenesis may be different due to diverse extent of dependence of α- and β-chains expression on the rules of allelic exclusion. Expression of transgenic β-chains results in the expansion of TCR repertoire diversity. Expression of β-chains is under strong control by allelic exclusion, resulting in formation of repertoire bearing mainly invariant transgenic β-chain pared with different α-chains and overall narrowing of repertoire. Earlier, we cloned genes encoding α- and β-chains of TCR of CD8+ memory cells specific to histocompatibility molecule H-2Kb . After introduction them in zigotes we have obtained transgenic mouse strains, which could be used for modeling of interactions between tumor cells and immune system of recipient. Normally, B10. D2 (R101) mice reject lymphoma EL4 cells in 12–14 days after transplantation, in spite of the fact, that allogeneic difference between B10. D2 (R101) (Kd Id Db ) mice and lymphoma EL4 (H-2b) cells is only in one product of MHC, the H-2Kb molecule. Transgenics carrying β-chains of TCR displayed compromised immunity to tumor cells resulting to their long persistence, tumor progression, the loss of H-2Kb molecule and death in 2–3 months after transplantation. This model allows to see all three phases of interaction between tumor and immune system of recipient – elimination, equilibrium and escape. Against, transgenics carrying α-chain reject tumor cells much more quickly, as in secondary immune response, in 3–6 days after transplantation. This rejection was mediated by intraepithelial T lymphocytes displaying features of resident memory cells – inability to recirculation, expression of CD103 and early activation antigen CD69 and intermediate density of T-cell markers CD3 and CD8. The capability to be located in nonlymphoid tissue and quickly destroy tumor cells makes them to be the most probable candidate to perform immunological surveillance functions.

Peripheral T lymphocytes can be subdivided into naive and antigen-experienced T cells. The latter, in turn, are represented by effector and central memory cells that are identified by different profiles of activation markers expression, such as CD44 and CD62L in mice. These markers determine different traffic of T lymphocytes in the organism, but hardly reproduce real antigenic experience of a T lymphocyte. Mechanisms of homeostasis maintenance of T lymphocytes with different activation phenotypes remain largely unknown. To investigate impact of T cell receptor (TCR) transgenic chains on formation of T lymphocytes, their peripheral survival and activation surface phenotypes, we have generated the transgenic mouse strain expressing transgenic β-chain of TCR 1D1 (belonging to the Vβ6 family) on the genetic background B10.D2(R101). Intrathymic development of T cells in these transgenic mice is not impaired. The repertoire of peripheral T lymphocytes in these mice contains 70–80% of T cells expressing transgenic β-chain and 20–30% of T cells expressing endogenous β-chains. The ratio of peripheral CD4+CD8− and CD4−CD8+ T lymphocytes remained unchanged in the transgenic animals, but the percent of T lymphocytes with the “naive” phenotype CD44−CD62L+ was significantly increased, whereas the levels of effector memory CD44+CD62L− and central memory CD44+CD62L+ T lymphocytes were markedly decreased in both subpopulations. On the contrary, T lymphocytes expressing endogenous β-chains had surface phenotype of activated T cells CD44+. Thus, for the first time we have shown that the pool of T lymphocytes with different activation phenotypes depends on the structure of T cell receptors.

Transgenic animal analysis has become a key approach used to study the gene functions and to model various human diseases, including autoimmune disorders. Such disorders are caused by the activation of T-cell clones whose T-cell receptors (TCRs) have a high affinity for syngeneic MHC molecules. The genes coding for the α and β chains of the autoreactive TCR were cloned from hybridoma 7, which was specific for syngeneic Ab MHC class II molecules. Amplified DNA fragments containing rearranged genomic DNA of the α and β chains of hybridoma 7 were cloned into special cassette vectors that contained the natural promoter and enhancer elements ensuring direct expression of the α- and β-chain genes in T cells of transgenic animals. The animals obtained with the vectors expressed the α or β chain on the majority of peripheral Tcells. The animals are suitable for studying the features of the intrathymic selection and maturation of T cells and provide an experimental model for developing new approaches to therapy of autoimmune diseases.

Experiments on mice deficient in expression of class I major histocompatibility complex molecules showed that memory CD8+ cells recognizing the alloantigen by the direct allogeneic recognition mechanism selectively proliferated in response to heated allogeneic cells. Adoptive transfer of memory cells from mice expressing green fluorescent protein transgene to wild-type animals showed for the first time that long-living memory cells suppress the response of naive T cells and abolish their involvement in the pool of memory cells. The pool of long-living memory T cells was obtained in vitro with heated allogeneic stimulators. Apart from immunizing alloantigen, this clone recognized foreign molecules of the major histocompatibility complex. Cloning and sequencing of rearranged regions in memory T cells showed that two α-chains and one functional β-chain are rearranged in cells of this pool. Only one α-chain was capable of forming protein product, which determines expression of only one form of T cell receptor. Experimental data directly confirm the hypothesis about degeneracy of recognition of allelic products of major histocompatibility complex molecules by T cell receptors. Suppression of the response of naive cells by memory cells probably underlies a previously unknown type of polarization of the immune response and determines clonal dominance and peripheral selection of T lymphocytes.