Numerous manual therapy techniques have been developed to deal with musculoskeletal pain, stiffness and associated spinal joint restrictions or loss of range of movement. Cervical vertebral mobilisation under anaesthetic was one of these. It was specifically developed to deliver an adequate and maintained dose or pressure when attempting to restore lost range of movement in the lower cervical and upper thoracic joint complexes of the horse. There was however a perceived reluctance amongst clinicians to explore this approach. They understandably preferred to utilise modalities that they were more comfortable with even though these were less likely to deliver a therapeutic dose.
The notion of an oral seal mechanism arose in an attempt to explain the rational behind a newly developed surgical procedure, an oral palatopharyngoplasty. This theory was further refined and described after viewing numerous treadmill recordings. Eventually its role in maintaining a patent nasopharyngeal airway was established and the term palatal instability was introduced. A critical review of the role or efficacy of surgical procedures, many of which were not originally designed to treat this condition was needed. Likewise the interrelationship between this mechanical dysfunction and other airways issues within the larynx and nasopharynx, along with the health of the lower airways in general, and a possible role in maintaining airway patency during paradoxical sleep, were in urgent need of investigation.
Cortisol is the principal glucocorticoid released by the adrenals in dogs and cats. Prolonged exposure to inappropriately elevated plasma concentrations of free cortisol leads to devolpment of Cushing’s syndrome or hyperadrenocorticism (HAC) (Rijnberk et al., 2010). HAC is typically a chronic and progressive disease, encountered in middle aged to older dogs. These dogs are usually in a good condition with excellent appetite. The clinical manifestations include polyuria, polydipsia, increased appetite, weight gain, abdominal enlargement, and cutaneous lesion. Laboratory findings include neutrophilia, monocytosis, increased alanine aminotransferase and alkaline phosphatase, increased triglycerides and cholestrol. Screening tests for HAC includes ACTH stimulation test, Low dose dexamethasone suppression test and Urinary cortisol : creatinine ratio. Diagnosis of HAC is confirmed by ultrasonography, Computed Tomography, Magnetic Resonance Imaging (Rijnberk et al., 2010). Laproscopic adrenalectomy is surgical procedure of choice in veterinary medicine or by the use of adrenocorticolytic and adrenocorticostatic drugs (Rijnberk et al., 2010). HAC is occasionally associated with fasting hyperglycemia, overt diabetes mellitus and ketoacidosis. The incidence of DM with HAC in dogs is approximately 16.6-22.0 % (Poppl et al., 2016). The clinical signs for DM are almost common to those of HAC (Polyuria, polydipsia, weight gain, hepatomegaly) (Hess et al., 2000). This communication puts on record a case of concurrent diabetic mellitus with Cushing syndrome in a dog.
The application of antibiotics as growth promoter in poultry has been banned, hence alternative growth promoters are required to be used. One of them is Homoeopathic remedies. The present study was conducted to evaluate the effect of Homoeopathic and Antibiotic growth promoters on growth performance and feed efficiency of commercial broiler chicken. A total of 144 straight-run day-old commercial broiler chicks were randomly distributed to three treatments (T1, T2, T3). Each treatment consisted of eight replicates and in each replicate, six chicks were there, leading to 48 chicks per treatment. Birds in T1 (Control), received basal diet, while birds of T2 group were provided with Antibiotic Growth Promoters (AGP, Avilamycin, 10 g/100 kg) through feed and T3 group provided with Homoeopathic Growth Promoter (HGP, 2 mL/L) through drinking water. Up to 6 weeks of age, the body weight in birds of control group was significantly (p
Gastrointestinal (GI) parasitic infestations pose a significant threat to livestock, leading to production losses, poor health, and even death, resulting in substantial economic losses for farmers. This study aimed to detect helminth parasitic infestations in buffaloes in Andhra Pradesh, India, and to examine, how these infestations vary by age, gender, and season. A total of 331 GI tracts from buffaloes processed at the Local Municipality Slaughterhouse in Vijayawada were examined over a period of one-year. Out of these, 228 tracts (68.9%) were found positive for various helminth parasites. The most prevalent parasite was Amphistomes (18.12%), followed by Schistosoma spindale (12.08%), Setaria spp. (15.4%), Cysticercus tenuicollis (5.43%), Monezia spp. (5.13%), Cooperia spp. (3.32%), Trichuris spp. (3.04%), Haemonchus spp. (2.11%), Gigantocotyle (1.20%), Bunostomum spp. (1.2%), Fasciola (0.90%), and Stilesia spp. (0.9%). The study also found that younger buffaloes (1 to 2.5 years old) had a higher infestation rate (73.11%) compared to older buffaloes, who had a prevalence rate of 61.34%. Female buffaloes had a significantly higher infestation rate of 96.96% compared to males (58.38%). Seasonal variations were observed, with 23.24% infestation in summer, 44.73% during the rainy, and 32.01% in winter season. This investigation showed that gastrointestinal (GI) parasitic infestations are widespread and occur at a relatively high rate in buffaloes of Andhra Pradesh causing severe economic loss to the farmers by reducing the overall productivity.
Pericarditis refers to inflammation of the pericardium, often accompanied by the accumulation of serous or fibrinous inflammatory substances. In cattle, it is almost exclusively caused by a foreign object from the reticulum penetrating the reticular wall, diaphragm, and pericardial sac. Key signs of pericarditis include tachycardia, muffled heart sounds, abnormal and asynchronous heart sounds, distended jugular veins, and edema in the submandibular region, brisket, and ventral abdomen Braun, 2009. Ultrasonography is the preferred method for diagnosing and characterizing pericardial effusion. Echogenic deposits and fibrin strands are visible on the epicardium, and the ventricles appear compressed by the effusion. Severe pleural effusion is typically observed as well. In cattle presenting with jugular vein distension and tachycardia, this diagnostic approach is particularly valuable (Mohanambal et al., 2018). In this present case, pericardiocentesis along with conservative treatment helped for the successful recovery of the animal.
For the present study, 480 tissue specimens of lungs were examined from carcasses of sheep of either sex, irrespective of age groups or breeds subjected to post-mortem examination from October 2023 to March 2024. Out of these, 126 samples representative of gross lesions were processed for subsequent histopathological examination. The overall occurrence of pneumonia in sheep recorded was 53.17 (67/126) %. The occurrence of various types of pneumonia, i.e., bronchopneumonia, interstitial pneumonia, fibrinous pneumonia, haemorrhagic pneumonia, suppurative pneumonia and granulomatous pneumonia were reported as 22.22, 18.25, 2.38, 4.76, 3.17 and 2.38 %, respectively. Bronchpneumonia was reported as the most prevalent, and fibrinous and granulomatous pneumonia least prevalent pneumonia affecting lungs of sheep during the study period.
An experiment was carried out to investigate the effect of dietary supplementation of Azolla meal on performance of commercial broiler chicken. A total of 144 straight-run day-old chicks were randomly assigned to six treatments, each consisting of 4 replicates with 6 chicks totalling 24 chicks per treatment. Birds in treatment T1 were fed with control basal diet, and those in T2, T3, T4, T5 and T6 received control basal diet supplemented with 5, 10, 15, 20 and 25% Azolla meal, respectively. Body weight (BW6) and body weight gain (BWG0-6) of birds fed with diet containing 5% Azolla meal (T2) up to 6th week of age were significantly (p
In order to compare the surface temperature of body extremities of Tharparkar and Karan Fries cattle under extreme climatic conditions during summer and winter season, the present study was carried out under standard managemental conditions. Environmental parameters, including temperature and humidity, were recorded daily, and Temperature Humidity Index (THI) and Black Globe Humidity Index (BGHI) were calculated to assess the level of thermal comfort on cattle. Thermal imaging (Infradred thermography, IRT) of body extremities (muzzle, nose bridge, ear tip and base, fetlock, and knee) were recorded twice weekly during winter (Dec. 2022–Jan. 2023), spring (Feb.–March 2023), and summer (June–July 2023) season. Skin extremities temperature was highest during summer followed by spring and winter season in both the breeds of cattle. Significant (p
The present study was conducted to evaluate and compare the accuracy and reliability of different methods of pregnancy diagnosis like PAG-based BovEasy rapid PD strip test kit at days 28, 32, 36 and transrectal ultrasonography on day 28 against per rectal palpation on day 45 post-AI for detection of early pregnancy in Gir cows and Jaffarabadi buffaloes. 22-days non-return postpartum healthy animals comprising 75 Gir cows and 75 Jaffarabadi buffaloes, (150,) aged 4 to 14 years, were selected from the Cattle Breeding Farm, KU, Junagadh. The BovEasy bovine rapid pregnancy detection test kits on Days 28, 32, and 36 post-AI showed high accuracy, sensitivity, and specificity across all time points in detecting early pregnancy as confirmed by USG on day 28 and per rectal palpation on day 45. For Gir cows, accuracy increased from 97.33% (on day 28) to 100% (on days 32 and 36), while Jaffarabadi buffaloes demonstrated 100% accuracy across all days. The combined data of cattle and buffaloes revealed accuracy improvement from 98.67% (on day 28) to 100% (on days 32 and 36), with sensitivity and specificity reaching 100%. The accuracy of transrectal ultrasonography on Day 28 post-AI for pregnancy was verified by presence of amniotic vesicle and fetal heartbeats against strip test on day 28 and per rectal palpation on day 45. It demonstrated 100% accuracy, sensitivity, and specificity in both breeds, with no false positive or negative result. The overall actual pregnancy rate was 36.7% (55/150). Overall, embryonic mortality was 4.7% (7/150). Reliability of early pregnancy detection methods when validated against per-rectal palpation results on Day 45 post-AI showed the similar results in both the species. Conception rate with diagnostic methods and embryonic mortality though higher in Gir cows did not differ from those in Jaffarabadi buffaloes.
This study investigated the prevalence of hard ticks infesting dairy cattle across four distinct agro-climatic zones in Western Maharashtra, India, shedding light on critical challenges in livestock management. From June to February, a thorough screening of 375 dairy cattle was conducted, with a meticulous collection of ticks from various regions of the body as well as from the surrounding environment. The findings revealed that out of 375, 200 animals were infested, indicating an alarming overall prevalence of 53.30%. Notably, calves under one year showed even greater susceptibility, with infestation rates soaring to 70.00%. Among different demographics, female cattle experienced higher infestation levels (54.60%; 160/293) compared to males (48.80%; 40/82). The prevalence in crossbred animals was 59.70% (12/206), non-descript breeds 45.70% (42/92), and in native breeds 45.50% (35/77). Cattle in poor body condition were disproportionately affected, exhibiting a striking 76.40% (81/106) infestation rate, in contrast to those in medium or good condition. Ticks favoured specific sites on the host, with the neck region (38.50%) and ears (15.50%) identified as the most common areas of infestation. This research underscores the urgent need for targeted control strategies to mitigate tick infestations in dairy cattle, particularly among vulnerable populations.
Total 8 mature healthy Kankrej bulls (7 replicates) were selected for evaluation of seminal attributes at fresh and frozen stage of cryopreservation. Seminal attributes evaluated included sperm viability, acrosome integrity, HOST-EN test, intracytoplasmic motile sperm selection (IMSI) and sperm mucus penetration test (SMPT). Based on the nuclear abnormalities, sperms were classified in Grade I, II, III and IV. Per cent sperm viability, acrosome integrity, HOST- reacted sperm and Grade I sperm were found significantly lower in frozen semen as compared to fresh semen. Grade IV sperm as assessed by IMSI tool was found significantly higher in frozen semen as compared to fresh semen. Correlation study revealed significant and positive correlations of sperm viability with acrosome integrity and HOST, while significant negative correlation with grade IV sperm. Sperm viability and acrosome integrity were positively correlated with SMPT. Key words: Cryopreservation, IMSI, Kankrej bull, Semen, SMPT
The need for the proper and convenient packaging methods of meat like tray packaging is surging in India. This study was designed to evaluate influence of low-density polyethylene (LDPE), linear low-density polyethylene (LLDPE), high density polyethylene (HDPE) and polyvinylchloride (PVC) wrap films on various physico-chemical properties (pH, instrumental colour, water activity, TBARS, tyrosine value and extract release volume) of boneless chicken at frozen (-18±2 °C) conditions. About 200 g of deboned chicken was aerobically packed separately in food grade polypropylene trays, heat sealed and studied at 1 month interval for 3 months. In frozen storage deboned chicken had good qualities in the case of all the treatment films for a period of 3 months. Tray packaged chicken sealed with HDPE film had better qualities and chicken sealed with PVC film had better colour (L, a,b) characteristics than that of other films. Thus, it can be concluded that tray packaging of meat sealed with HDPE film can be successfully used under frozen conditions for maintenance of better quality.
The pericardium is a hard, fibroelastic sac that encloses the heart, with the ability to stretch appreciably in dogs tormented by pericardial effusion (PE) (Lorell and Braunwald, 1984). PE is characterized with the aid of a bizarre buildup of fluid in the pericardial space, at the same time as small volumes of PE won’t produce medical signs and symptoms, will increase in fluid volume and pressure can cause cardiac tamponade. The most common causes of PE in dogs are cardiac neoplasia, right sided heart failure, cardiac rupture, and idiopathic pericarditis and less commonly congenital pericardial disorders, trauma, or infectious origin. Pericardial tumors can make contributions to both pleural and pericardial effusions in dogs (Scollan et al., 2015). Blood analysis might also display mild anaemia and leukocytosis in cases regarding pericardial tumors, in particular haemangiosarcoma (Shaw and Rush 2007). The common physical findings in dogs with pericardial and pleural effusion encompass Muffled heart sounds, jugular vein distention, tachycardia, abdominal distension, abdominal respiration, poor pulse quality, ascites, dyspnea, and tachypnea (Kladakis et al, 2018). In lateral thoracic radiographs, the coronary heart often seems globoid or rounded. PE is now and again mistaken for dilated cardiomyopathy (DCM), and pleural effusion may also be seen on radiographs. Common ECG findings in dogs with PE encompass sinus tachycardia, ventricular arrhythmias, low voltage QRS complexes, ST phase elevation, and electrical alternans (Guglielmini et al., 2012). Echocardiography is a non-invasive and enormously effective diagnostic tool for detecting even small amounts of PE. The presence of PE itself complements visualization of the masses on the heart, because the fluid acts as a assessment medium (MacGregor et al., 2005). Echocardiography is considered the gold standard well known for diagnosing PE and formulating a therapeutic plan (Shaw and Rush, 2007). Treatment for pericardial and pleural effusion consists of pericardiocentesis and thoracocentesis, respectively, at the side of diuretic remedy. Chemotherapy may be considered in instances of cardiac neoplasia (Shaw and Rush, 2007). This communication reports successful management of pericardial and pleural effusion in a dog with pericardial mass.
This study evaluated the impact of fruit waste supplementation on the haemato-biochemical profile of camels. A 42-days trial was conducted with 10 camels, randomly assigned to two groups (five per group) using a randomized block design (RBD). T1 (control) received a 50:50 mix of guar and groundnut straw, while T2 was supplemented with 5% fruit waste (banana, papaya, watermelon) in the basal diet in fresh form (DM basis). Results showed significantly higher haemoglobin (p≤0.01) and packed cell volume (p≤0.05) in T2, whereas no significant changes were observed in biochemical parameters. Thus, fruit waste can be used as a cheaper feed resource at level of 5% of the diet without any adverse effects on haemato-biochemical parameters of camels.
This research work highlights the alarming prevalence of Ixodidae ticks infesting dogs across four distinct agro-climatic zones of Western Maharashtra. A total of 220 dogs were screened, resulting in 100 tick samples identified through rigorous methods. Findings revealed a concerning overall prevalence of 45.5% (100/220) of Ixodid ticks in the region, with Rhipicephalus sanguineus as the predominant species, comprising 53% (53/100) of the samples. Remarkably, dogs aged 1 to 3 years showed the highest infestation rate at 49.4% (38/77). Male dogs were disproportionately affected, with a prevalence of 52% (53/102). Stray dogs emerged as particularly vulnerable hosts, exhibiting an alarming infestation rate of 57.4% (39/68). Among breeds, the Greyhound demonstrated the highest prevalence at 63.3% (19/30). Moreover, skinny dogs faced the most significant tick burden, with a striking 70% (7/10) infestation rate. The ear was identified as the most common attachment site for ticks, accounting for 43% (43/100) of occurrences. This comprehensive study emphasizes the urgent need for targeted interventions to combat tick infestations in dogs across Western Maharashtra.
The present work was undertaken to study antimicrobial and antibiofilm effect of essential oils on the biofilm producing Staphylococcus aureus isolated from the bovine mastitis milk. Out of 164 dairy cattle and buffalo milk samples screened, 24 samples were found positive for mastitis by CMT. Among these, 17 S. aureus isolates were identified and characterized phenotypically by standard biochemical tests. The biofilm formation ability of the isolates was studied by Congo red agar, Light microscopy method and Microtiter plate (Crystal Violet) method. The antimicrobial activity and antibiofilm effect of essential oils - Garlic and Cinnamon oil - on biofilm positive S. aureus were studied by agar well diffusion method and Microtiter plate method, respectively. Cefoperazone was used as standard control drug. Out of the total 17 S. aureus strains,70% were positive on Congo red agar, 52% by Light microscopy and 100% on Microtiter plate method. By the Microtiter plate method, 4 strains were strong biofilm producers and 13 were weak biofilm producers. Cinnamon oil showed better antibiofilm activity in all the concentration used (1%, 2%, 3%). Garlic oil showed good antimicrobial and antibiofilm activity at 3% concentration.It was concluded that biofilm producing Staphylococcus aureus was isolated from bovine mastitis milk samples, and sensitivity of Congo red agar, Light microscopy and Microtiter plate methods was good. Micro titre plate showed highest sensitivity for detection of biofilm production. Garlic oil and Cinnamon oil showed antimicrobial and antibiofilm producing abilityagainst S. aureus.
Bovine tuberculosis (bTB) is a zoonotic disease that affects domestic animals, humans, and the wild animals. The purpose of the study was to use the comparative intradermal tuberculin test to diagnose bTB in cattle and to find out the prevalence in unorganized, and organized farm with variation according to age, sex, and breed. Eighty three animals were tested with the use of comparative intradermal tuberculin test across two districts of Punjab, India. Additionally, ante-mortem (nasal swab, n=44) samples were examined using molecular methods. The samples were inoculated on Middlebrook7H10 media after decontamination with 4% NaOH. One sample revealed the presence of acid fast bacilli on microscopic examination. Out of 83 animals examined, 12 were bTB positive reactors. Additionally, gender-wise data analysis revealed higher positivity among cows/heifers (16.17%, 11/68) compared to bulls/bullocks (6.66%, 1/15). Out of the 44 nasal swab samples, 3 samples yielded Mycobacterium kansasii isolates on culture which were further confirmed by species specific PCR. The finding of our study indicates animals of indigenous cattle breed in Ludhiana have a higher prevalence of bTB and variation in breed susceptibility. The presence of non-tuberculous mycobacteria may hamper diagnosing bovine tuberculosis in cattle.
Theileriosis is one of the common economic concerns in cattle, and normally hyalomma ticks transmit it. The estimated economic loss due to tropical theileriosis in India is INR 8,426.7 crore (Narladkar, 2018). Cattle have been thought to be susceptible animals in older days; however, the disease is also prevalent in buffalo, sheep and goats. Pale mucus membrane, enlarged lymph nodes, progressive weight loss and high fever are the routinely observed clinical signs in cattle (Patel et al., 2022). Blood smear examination and molecular confirmation are widely adopted for diagnosis. In large ruminants, various unusual clinical signs, including exophthalmos and pseudo-pericarditis, have been reported for a long time (Prajapati et al., 2019). Pseudo-pericarditis refers to jugular engorgement and edema of the brisket and ventral abdominal wall resulting from pressure at the cranial and caudal vena cava, which return blood to the heart (Radostits et al., 2000). The reported condition must be differentiated from true pericarditis for proper therapeutic management. In this case, the diagnosis of pseudopericarditis has been described along with management in cattle Ca s e Hi s to ry a n d Ob s e r vat i o n An eight-year-old crossbred cow with a history of brisket edema for the last 3 months, laboured breathing, enlarged pre-scapular lymph node and blackish bloody diarrhoea was brought for treatment at Veterinary Clinical Complex, Deesa, Gujarat India (Fig. 1A). Primary examination revealed a pale conjunctival mucus membrane and 103ºF rectal temperature. Ferroscopy carried out to rule out the presence of a foreign body was found to be negative. A small amount of faeces was collected to evaluate the parasitic load in the body, and no ova of any parasites were found. 2 mL of blood was collected for further investigation. The complete blood count revealed white blood cells 20.34 x 103/µL,, red blood cells 1.71 x 106/μL, haemoglobin 2.2 g/dL, packed cell volume 7.05 %, platelets 360 x 103/μL, lymphocyte 27%, monocyte 1 % and neutrophils 72 %. The field-stained blood smear examination revealed Koch’s blue bodies in lymphocytes (Fig. 1B). Meanwhile, an ultrasonographic evaluation of the thorax was carried out using a 2-5 MHz convex probe, and an accumulation of fluid around the heart was recorded (Fig. 1C). Further, PCR done for molecular confirmation of T. annulata infection using forward primer CCAGGACCACCCTCAAGTTC and reverse
An inguinal hernia, also called as bubonocele is a protrusion of an organ or part of an organ, fat or tissue through the inguinal ring, i.e. the region in the groin where the abdominal musculature meets the hind legs (Byers et al., 2007). Inguinal hernia may be classified as direct or indirect inguinal hernia, congenital or acquired inguinal hernia, unilateral or bilateral inguinal hernia and traumatic or non-traumatic inguinal hernia. Contents of the inguinal hernia include omentum, fat, ovary, uterus, small intestine, colon, bladder or spleen (Kumar et al., 2020). Clinical signs often reflect the size of the hernia and the hernial contents and range from painless inguinal mass to signs related to incarcerated or nonviable small intestine (Waters et al., 1993). The present report describes the successful surgical management of unilateral incarcerated inguinal enterocele in a dog.
