e22223 Background: Hereditary breast carcinomas that are attributable to BRCA1 mutations have their own morphological and immunohistochemical characteristics. This study was aimed to analyze the level of expression of steroids (estrogen and progesterone) and HER2-neu receptors in BRCA1 associated breast cancer. Methods: DNA patterns from 264 patients with hereditary breast cancers (breast cancer diagnosed at the age under 40; bilateral breast cancer; combination of breast and ovarian cancers; 2 and more breast cancers in blood relatives). All the patients were residents of the Altai Territory. BRCA1 gene mutations were registered in 34 patients (12.9%): 5382insC gene mutation - in 28 patients; 300A/C - in 2 patients; 4153del - in 3 patients; 185del - in 1 patient. The frequency of the BRCA1 5382insC allele mutation was 7.3; 300A/C - 0.52; 4153del - 0.26; 185del - 0.83. Immunohistochemical characteristics of BRCA1-associated breast tumors tissue from these patients were investigated. Results: 32 BRCA1-associated breast carcinomas were estrogen receptor- negative; 1 - week positive (H-score 50–100); 1 - moderate positive (H- score 100–200). 33 BRCA1-associated breast carcinomas were progesterone receptor- negative; 1 - positive (H-score 200 and more). HER2-negative were 31 BRCA1-associated breast carcinomas; 2 were week positive (HER2-neu +); 1 - was moderate positive (HER2-neu ++). Conclusion: BRCA1-associated beast carcinomas have been found to be more frequently estrogen receptor-, progesterone receptor-, and HER2- negative. These data show that hereditary breast cancer associated with BRCA1 gene mutations poses poor prognosis. No significant financial relationships to disclose.

The incidence of homozygote deletion of glutathione S-transferase genes M1 and T1 (null genotypes; or GSTM1“-” and GSTT1“-”) was studied in breast cancer patients living in Altai Krai. DNA was isolated from blood samples of 695 breast cancer patients (291 patients with familial cancer and 404 patients with sporadic cancer) and 263 women without history of tumor diseases. The frequency of GSTM1“-” and с GSTT1“-” genotypes was estimated in breast can cer patients (47.2 and 19.1%, respectively) and non-cancer participants (46.8 and 19.0%, respectively). No differences were found in the frequency of genotypes. The frequency of genotype combination GSTM1“-”+GSTT1“-” in patients with sporadic breast cancer (11.6%, 47 of 404 patients) was higher than in the control (6.1%, 16 of 263 patients; OR=2.03; 95% CI=2.09-3.83; p=0.02). The genotype frequency of genes in the control group did not differ from that in European residents of the Caucasian race.

The incidence of MnSOD genotypes in residents of the Altai Region suffering from breast cancer and individuals without a history of cancer corresponded to the Hardy-Weinberg equilibrium. No association of MnSOD with the incidence of sporadic breast cancer was detected. No association of MnSOD, tobacco smoking, or menopausal status, on the one hand, and breast cancer development, on the other, was detected.

22133 Background: Many investigators consider MPT typical for patients from families with cancer history, but the characteristics of polyneoplasia in this group of patients are still to be analyzed. Methods: The registry of patients from “cancer”-families (who had 3 and more relatives by blood with cancers), formed in Altai oncological centre, included 1986 patients (196 male and 1790 female) ages 28 to 74. All of them were kept under medical observation according to in-house designed algorithms. MPT in this group were analyzed as compared to general population of the Altai territory (the data of the Altai territory cancer registry). Results: MPT were registered in 28 patients (27 female and 1 male) from “cancer”-families (all in early stages). The proportion of patients with MPC in this group was significantly higher (1.4%) than in general population (0.66%). The average age of the patients at the moment of first cancer revealing (47.6 years) was significantly lower than the same in general population (59.7 years). In the group of patients from “cancer”-families with MPT there were more patients in younger ages as compared to the same in general population: at the age before 29 - 3.6% and 2.6%, respectively; 30–39 years old - 21.4% and 4.1%, respectively; 40–49 years old - 32.1% and 13.8%, respectively. 4 patients from “cancer”-families had synchronous MPT, 24 - metachronous. The mean interval between the first and the second cancer was 6,6 years. Combinations of the tumours of reproductive system (breast, ovarian cancer, cancer of cervix and corpus uteri) and thyroid cancer were the most frequent. Conclusion: In the group of patients from “cancer”-families MPT were registered more often, than in general population and in younger ages. Patients with MPT from this group most often had cancers of reproductive system. Medical observation of this group of patients organized in proper way made it possible to predict and reveal cancers in early stages. No significant financial relationships to disclose.

21185 Background: NQO1 is a two-electron reductase, which metabolizes a variety of xenobiotics. This FAD-binding protein forms homodimers and reduces quinones to hydroquinones. This protein's enzymatic activity prevents the one electron reduction of quinones that results in the production of radical species. Mutations in this gene have been associated with tardive dyskinesia (TD), an increased risk of hematotoxicity after exposure to benzene, and susceptibility to various forms of cancer. Genetic polymorphism of NQO1 is a C to T point mutation at base pair 609 of exon 6, which codes for a proline to serine substitution in NQO1 protein. This mutation results in a loss of NQO1 activity. Previously it was reported that wild-type NQO1 increased lung adenocarcinoma risk among male smokers in Taiwan. The association of the P187S polymorphism with breast cancer found in study of two independent populations (one from Tyrol, Austria, and the other from Prague, Czech Republic) (Menzel et al., 2004). Methods: The purpose of this study was to determine whether polymorphism in the NQO1 gene may influence breast cancer risk in Siberian population. The prevalent case-control design was used. The cases were 203 patients with breast cancer. Controls consisted of 182 noncancer outpatients. Genotyping for detecting of NQO1 gene polymorphism was performed using PCR amplification with the primer set of 5'- ACGCTAGCTCTGAACTGATTCTCT -3' and 5'- TTTTCTCCTCATCCTGTACCTCT –3’. The amplified PCR products were digested with HinfI and analyzed using electrophoresis on a 2.5% agarose gel. Results: Compared to subjects having C alleles (genotype CC), odds ratio (chi2=0.04, p=0.84309) were 1.116 (0.376–3.311) for subjects having genotype TT. Conclusions: These results suggest that polymorphic variation P187S of the NQO1 gene has no influence on breast cancer risk in Siberian women. No significant financial relationships to disclose.

1542 Background: Existent genetic tests are not able to provide effective forecasting of all cancer sites and all those methods are generally expensive. At the same time approximately 50% of population has cancer susceptibility and 10% - hereditary cancer syndromes. The purpose of this study was to develop the algorithm of monitoring to provide effective forecasting and prevention of cancer in patients with hereditary cancer susceptibility. Methods: The algorithm of monitoring of patients with family history of cancer includes 2 stage: I - diagnostic, II - treatment and rehabilitation. In the I stage patients with 3 and more relatives by blood who had cancers of any site are revealed by oncologist. Their genealogical trees are analyzed by geneticist. All those patients are registered in the registry of “cancer”-families’ members, interviewed and got all the necessary diagnostic procedures with the following multivariative analysis (of more than 200 geno- and phenotypic characteristics). Patients with determined high risk of malignancies undergo deep clinical and instrumental examination, site-by-site searching for cancer, molecular genetic tests. In the II stage individual recommendations for the patients are developed, pretumour lesions are treated, preventative surgery is performed (resection of a target organ) and the measures for strengthening of anti-tumour resistance are taken. All the patients of the registry get the periodic health examination for term of life: preventive examination once per 6 months, multivariative analysis once per 3 years. Results: The registry of “cancer”-families’ members included 421 families - 1833 patients (232 men and 1601 women at the age of 28–74). In 2003–2006 there were revealed obligatory pre-cancer lesions in 637 patients, cancers in situ - in 45 patients, and cancers of different sites - in 69 patients (in I stage - 78.3%, II stage - 18.9%, III stage - 2.8%, IV stage - 0). Conclusions: This algorithm of monitoring of the patients from the registry of “cancer”-families’ members made it possible to provide high effectiveness of cancer prevention and early detection. No significant financial relationships to disclose.