Rice sheath blight (ShB), induced by the necrotrophic fungus Rhizoctonia solani, causes substantial losses in rice (Oryza sativa L.) production, and elucidating the resistance mechanisms is key to controlling pathogen spread. In this study, transcriptomics analysis of rice cultivar Shennong 9816 responding to R. solani AG1-IA infection identified 4542 differentially expressed genes (DEGs; p < 0.05, |log2FC| ≥ 1). Subsequently, gene ontology (GO) and kyoto encyclopedia of genes and genomes (KEGG) analyses of the DEGs revealed significant enrichment in "protein phosphorylation", "plant-pathogen interaction", and "plant-type hypersensitive response". The calcium-binding protein 45 (CML45), calcium-binding protein 36 (CML36), CPK35, wall-associated kinase 2 (WAK2), MSL, Ca2+-binding protein, and WRKY70 genes were upregulated. Overexpression of OsCML45 and OsCML36 was associated with enhanced resistance to R. solani in rice. Moreover, the rice plants overexpressing OsCML45 and OsCML36 showed increased physiological traits. Taken together, these results indicate that OsCML45 and OsCML36 are candidate regulators in rice responses to sheath blight.

Chilli veinal mottle virus (ChiVMV) has been reported to infect Solanaceous crops in recent years, causing severe damage to crop yields. Previous studies have demonstrated that various nutrient elements can improve plant resistance through different strategies. However, there are no reports on the regulation of the resistance to ChiVMV infection by nutrient elements in tobacco. In this study, we found that viral infection decreased calcium (Ca) content in tobacco plants. Interestingly, exogenous application of Ca(NO3)2 improved tobacco resistance to ChiVMV infection. Meanwhile, the key genes and pathways of Ca-induced resistance to ChiVMV infection were verified through transcriptome sequencing analysis. Among them, NtTPS9–2 related to trehalose synthesis and NtEIN3–5 related to ethylene signal transduction were up-regulated in ChiVMV-infected plants and regulated by Ca spraying. Further research demonstrated that silencing the homologous genes of these two genes enhanced the resistance of Nicotiana benthamiana to ChiVMV infection. Our research reveals that Ca element is involved in the regulatory network of viral disease resistance in tobacco, providing a worthy foundation for the cultivation management and molecular design breeding of tobacco plants.

Tomato yellow leaf curl virus (TYLCV) poses a serious threat to global tomato production. Current management strategies remain limited, highlighting the need for novel antiviral agents. In this study, we evaluated the efficacy of a newly synthesized pyrimidine-guanidine derivative, YYH-6, against TYLCV in tomato (Solanum lycopersicum cv. Micro-Tom) and investigated its underlying mechanisms. Foliar application of YYH-6 significantly reduced viral accumulation and alleviated disease symptoms. Transcriptomic analysis revealed that YYH-6 treatment upregulates defense-related pathways such as plant-pathogen interaction, MAPK signaling, and phenylpropanoid biosynthesis. Results of TRV-based virus-induced gene silencing (VIGS) further indicate that RPP13 and ALS2 function as important resistance genes induced by YYH-6. Activity-based protein profiling, LC-MS/MS, and reverse genetic verification by VIGS indicate that serine hydroxymethyltransferase and STI1 domain-containing proteins are potential target proteins of YYH-6 for TYLCV inhibition. Our findings demonstrate that YYH-6 suppresses TYLCV infection through multitarget modulation of host defense pathways, making it a promising candidate for sustainable management of tomato viral diseases.

Identification of pesticide targets is of great significance for the development of new pesticides. The new compound GLY-15, containing a pyrimidine heterocycle and a moroxydine skeleton structure, has good anti-TMV activity, but the underlying molecular targets and mechanism of action remain elusive. Here, host malate dehydrogenase (MDH), glyceraldehyde-3-phosphate dehydrogenase (GAPDH), and tobacco mosaic virus (TMV) coat protein (CP) were identified as potential targets of GLY-15 using activity-based protein profiling (ABPP) and drug affinity responsive target stability (DARTS), and their interactions with GLY-15 were validated by microscale thermophoresis (MST) and pull-down analysis. Functional analyses demonstrate that MDH silencing significantly reduces TMV accumulation, while transient overexpression of MDH results in elevated viral infection. Meanwhile, yeast two-hybrid (Y2H), co-immunoprecipitation (Co-IP), and bimolecular fluorescence complementation (BiFC) analysis uncover that MDH interacts with CP, and their interaction is effectively inhibited by GLY-15. Site-directed mutagenesis identifies E225 as a critical residue for both GLY-15/MDH binding and MDH/CP interaction. Further investigations reveal that GLY-15 functions as an MDH inhibitor and affects its interaction with CP. Meanwhile, we showed that GLY-15 targeting MDH indicates broad antiviral activity against pepper mild mottle virus (PMMoV) and potato virus Y (PVY). This investigation systematically reveals novel insights into the anti-TMV mechanisms of GLY-15, establishing a valuable theoretical basis for antiviral target discovery and plant disease resistance breeding.

Watermelon diseases have become increasingly severe in Liaoning Province, which is a major watermelon-growing region in China. To investigate the occurrence of watermelon virus diseases and identify the predominant virus types, 330 symptomatic samples from three major producing areas in Liaoning Province (Yingkou City, Xinmin City, Chaoyang City) were tested by seven specific primer pairs using reverse transcription-polymerase chain reaction (RT-PCR). The detection results indicated that the incidence of cucumber green mottle mosaic virus (CGMMV) was 54.85% (181/330), followed by watermelon mosaic virus (WMV) with an incidence of 15.76% (52/330). Considering CGMMV’s predominance and the extensive application of grafting in watermelon production, the disease resistance of nine commercially available rootstocks with diverse Cucurbitaceae backgrounds was evaluated. The results showed that all three pumpkin-type rootstocks uniformly exhibited robust resistance to CGMMV, with significantly lower viral accumulation. The bottle gourd rootstock also demonstrated strong resistance to CGMMV. However, wild watermelon rootstocks, due to intraspecific variation and genetic diversity within their germplasm, display a bimodal distribution of high resistance and high susceptibility. These results confirm that CGMMV is the primary watermelon virus in Liaoning Province and highlight the use of pumpkin-type rootstocks as an effective grafting strategy to enhance CGMMV resistance.

Tomato mottle mosaic virus (ToMMV) is a major threat to cultivating tomatoes and other solanaceous plants. Here, an infectious clone of the ToMMV Huludao isolate was constructed, and ToMMV infection significantly reduces soluble sugar, soluble phenolic, and vitamin C contents, while increases titratable acid content in Micro-Tom fruits, thus altering their flavor profile and quality. Integrated transcriptomic and metabolomic analysis indicate that ToMMV infection induced 2090 differentially expressed genes and 709 differentially accumulated metabolites in Micro-Tom fruits. Then, functional analysis using gene silencing validated that bifunctional 3-dehydroquinate dehydratase/shikimate dehydrogenase and glyceraldehyde-3-phosphate dehydrogenase induced by ToMMV in the amino acid biosynthesis pathway play critical roles in tomato fruit quality, while 4-coumarate-CoA ligase, phenylalanine ammonia-lyase and scopoletin glucosyltransferase in the phenylpropanoid biosynthesis pathway were required for host resistance. Our findings elucidate molecular mechanisms of ToMMV-induced fruit quality alteration and highlight metabolic targets for enhanced viral resistance in tomatoes.

This study analyzed the transcriptome, proteome and ubiquitylome of ToBRFV-infected tomato plants and verified the antiviral roles of SlCHS, SlPAO, and SlCCoAOMT in tomato plants through TRV-VIGS assays. Tomato brown rugose fruit virus (ToBRFV) infection causes leaf mottling and fruit wrinkling, significantly affecting tomato quality. Understanding the mechanisms of tomato plants in combating ToBRFV infection is fundamental to the development of effective strategies for viral disease control and management. To investigate the effects of ToBRFV infection on the gene regulatory network of tomato plants, we performed transcriptome, proteome and ubiquitylome sequencing on ToBRFV-infected tomato plants. A total of 874 differentially expressed genes (DEGs) and 675 differentially expressed proteins (DEPs) were identified. Most of them were involved in hormone signal transduction, MAPK signaling pathway, flavonoid biosynthesis, arginine and proline metabolism, and phenylalanine metabolism, and some of these proteins were modified by ubiquitination. Furthermore, virus-induced gene silencing (VIGS) assays revealed that silencing SlCCoAOMT or SlCHS, two flavonoid biosynthesis-related genes, enhanced tomato resistance to ToBRFV infection, while silencing SlPAO, an arginine and proline metabolism-related gene, promoted ToBRFV infection. These results reveal the key regulatory networks of tomato in response to ToBRFV infection, and identify SlCCoAOMT, SlCHS and SlPAO as potential candidate genes for disease-resistant breeding.

Tomato leaf curl New Delhi virus (ToLCNDV) is a bipartite begomovirus (family Geminiviridae) originally isolated from tomatoes and later evolved to cross-infect cucurbit crops, causing severe economic damage in Asia and Europe. In this study, we sequenced and characterized complete genomes of two ToLCNDV isolates collected from Hebei (ToLCNDV-HB) and Jiangsu (ToLCNDV-JS) provinces of China infecting melon. We constructed infectious clones for ToLCNDV-HB and ToLCNDV-JS, which could systemically infect Nicotiana benthamiana, tomato, and four species of cucurbitaceous plants. Notably, ToLCNDV-HB induced more severe symptoms and accumulated higher viral DNA and protein accumulation than ToLCNDV-JS in N. benthamiana, melon, and bottle gourd. Sequence analysis showed that sequence variations are present only in AV2, AC1, and AC4. However, only the AV2 ORF from ToLCNDV-HB was more efficient than that from that ToLCNDV-JS in enhancing potato X virus’s pathogenicity and suppressing post-transcriptional gene silencing (PTGS). An AV2-swapping experiment between ToLCNDV-HB and ToLCNDV-JS confirmed its vital role in determining the differential pathogenicity. Further evidence shows that virions from both clones are mechanically transmissible. This is the first report comparing the differential pathogenicity of two Chinese ToLCNDV isolates in cucurbits. The AV2 protein, a key pathogenicity determinant, represents a potential target for breeding ToLCNDV-resistant cucurbit varieties.

The necrotrophic fungal pathogen Rhizoctonia solani anastomosis group 3 (AG3-TB) is a major cause of global tobacco crop yield losses. Secreted proteins produced by filamentous fungi, as important virulence factors, play a core role in the interaction between plants and pathogens. In this study, we identified a secretory protein, RsDN3377, which localised to the intercellular space and induced cell death in Nicotiana benthamiana. Heterologous expression in Escherichia coli coupled with matrix-assisted laser desorption/ionisation time-of-flight mass spectrometry analysis confirmed RsDN3377 possessed deacetylase activity. In addition, RsDN3377 was an essential pathogenicity factor for mycelial development by double-stranded RNA-mediated gene silencing. Through yeast two-hybrid and bimolecular fluorescence complementation assays, we demonstrated that RsDN3377 interacted with the calcium-binding protein NtCML19. In addition, transgenic Yunyan 87 overexpressing NtCML19 exhibited enhanced resistance to R. solani AG3-TB infection. Microscale thermophoresis analysis verified the calcium-binding activity of NtCML19. These lines of evidence indicate that the deacetylase RsDN3377 is secreted by R. solani AG3-TB, and this protein, critical for promoting fungal mycelial development and pathogenicity, was disrupted by its resistance-related interaction with NtCML19.

Cytidine peptide compounds have emerged as promising candidates for antiviral agents, but their large-scale production and mode of action remain underexplored. By optimizing temperature control and stirring efficiency, and replacing trifluoroacetic acid with an HCl/dioxane system for tert-butyloxycarbonyl (Boc) deprotection, efficient preparation of SN15 was achieved with a 78.47 % yield without the need for column chromatographic purification. Antiviral assays showed that SN15 inhibited TMV accumulation in single cells by 53.44 % at 250 μg/mL and significantly suppressed systemic infections by PVY, PMMoV, and TuMV, reducing viral RNA accumulation by 54.16 %, 41.14 %, and 61.85 %, respectively. Transcriptomic analysis identified 9676 differentially expressed genes (DEGs), with ribosomal protein-related pathways significantly upregulated and hormone signaling/ubiquitination pathways downregulated. Proteomic analysis revealed 216 differentially expressed proteins (DEPs), including ribosomal components and stress-response proteins, consistent with transcriptomic trends. Results of TRV-VIGS showed that silencing of 60S ribosomal protein L6 or lipid transfer-like protein VAS significantly increased TMV accumulation, confirming its critical role in antiviral defense, while silencing of peroxidase N1 precursor and E3 ubiquitin-protein ligase CIP8-like isoform X1 inhibited viral replication. This study reveals the molecular mechanism by which SN15 exerts antiviral effects through multi-pathway synergistic regulation, and provides a theoretical basis for the industrial production and broad-spectrum antiviral application of the fluorinated cytidine peptide compound SN15.

The co-infection of maize chlorotic mottle virus (MCMV) and sugarcane mosaic virus (SCMV) causes maize lethal necrosis (MLN), which seriously affects the yield and quality of maize. Ubiquitination is one of the most important protein post-translational modifications. However, the role of ubiquitination modification in regulating maize resistance to viral infection remains largely unknown. In this study, we found that the ubiquitination levels in SCMV- and/or MCMV-infected maize plants were higher than that in the non-infected maize plants. Ubiquitinome and proteome analyses of the above maize plants revealed that most down-regulated differentially accumulated proteins that possessed up-regulated lysine ubiquitination sites were mainly involved in photosynthesis, fructose and mannose metabolism, and glyoxylate and dicarboxylate metabolism. Functional analyses of three DAPs involved in glyoxylate metabolism demonstrated that silencing ZmGOX1 facilitated SCMV and MCMV single and co-infection, while knockdown of ZmHPR1 or ZmHPR2 suppressed viral infections. Moreover, overexpression of ZmGOX1 and its mutants at Kub sites enhanced maize resistance to SCMV infection. We also found that exogenous application of sodium sulphide could up-regulate the expression of ZmGOX1 and effectively inhibit viral infections. These findings provide novel insights into the roles of ubiquitination in the regulation of maize resistance to viral infection.

Rhizoctonia solani is a fungal pathogen that causes significant losses in agricultural production. Because of its rapid transmission and broad host range, the exploration of genes involved in defense responses to the infection of R. solani has become an important task. Here, we performed a time‐course RNA‐Seq experiment to explore crucial genes or pathways involved in host responses to R. solani AG3‐TB infection at 6, 12, 24, 36, 48, and 72 hours post inoculation (hpi). GO and KEGG enrichment analysis revealed that most DEGs were enriched in the basal metabolism pathways, including carbohydrate metabolic processes and the biosynthesis of amino acids. Moreover, catalase (CAT) and superoxide dismutase (SOD) were up‐regulated, and transcription factors (TFs) such as WRKY, AP2, and MYB were increased significantly compared to the control (0 hpi). Silencing of WRKY70 and catalase‐3 exhibited elevated susceptibility to the fungal infection. To summarize, the TFs WRKY70 and WRKY75, genes involved in jasmonic acid (JA), salicylic acid (SA), and brassinosteroids (BR) signaling pathways, and defense‐related enzymes may play crucial roles in the host responses to R. solani AG3‐TB infection.

The production and scavenging of reactive oxygen species (ROS) are critical for plants to adapt to biotic and abiotic stresses. In this study, we investigated the interaction between the coat protein (CP) of cucumber green mottle mosaic virus (CGMMV) and ATP synthase subunit δ (ATPδ) in mitochondria. Silencing of ATPδ by tobacco rattle virus-based virus-induced gene silencing impeded CGMMV accumulation in Nicotiana benthamiana leaves. Both the overexpression of ATPδ in transgenic plants and transient expression promoted CGMMV infection. Nitro blue tetrazolium (NBT) and 3,3'-diaminobenzidine (DAB) staining revealed that ATPδ inhibited O2 - production but not H2O2 production. The treatment of CGMMV-infected leaves with the ROS inhibitor diphenylene iodonium (DPI) induced a ROS burst that inhibited CGMMV infection. Reverse transcription-quantitative PCR and superoxide dismutase (SOD) activity assays showed that ATPδ, CGMMV infection, and CP expression specifically induced NbFeSOD3/4 expression and SOD activity, and silencing NbFeSOD3/4 inhibited CGMMV infection. We speculate that CGMMV CP interacts with ATPδ and hijacks it, thereby enhancing O2 - quenching by upregulating NbFeSOD expression and, in turn, SOD activity.

The occurrence of geminiviruses causes significant economic losses in many economically important crops. In this study, a novel geminivirus isolated from tobacco in Sichuan province of China, named tomato leaf curl Chuxiong virus (TLCCxV), was characterized by small RNA-based deep sequencing. The full-length of TLCCxV genome was determined to be 2744 nucleotides (nt) encoding six open reading frames. Phylogenetic and genome-wide pairwise identity analysis revealed that TLCCxV shared less than 91% identities with reported geminiviruses. A TLCCxV infectious clone was constructed and successfully infected Nicotiana benthamiana, N. tabacum, N. glutinosa, Solanum lycopersicum and Petunia hybrida plants. Furthermore, expression of the V2, C1 and C4 proteins through a potato virus X vector caused severe chlorosis or necrosis symptom in N. benthamiana. Taken together, we identified a new geminivirus in tobacco plants, and found that V2, C1 and C4 contribute to symptom development.

Cytidine has a broad range of applications in the pharmaceutical field as an intermediate of antitumor or antiviral agent. Here, a series of new cytidine peptide compounds were synthesized using cytidine and Boc group-protected amino acids and analyzed for their antiviral activities against tobacco mosaic virus (TMV). Among these compounds, the structure of an effective antiviral cytidine peptide SN11 was characterized by H-1 NMR, C-13 NMR, and high-resolution mass spectrometer. The compound SN11 has a molecular formula of C15H22N6O8 and is named 2-amino-N-(2- ((1- (3,4-dihydroxy-5-(hydroxymethyl) tetrahydrofuran-2-yl) -2-oxo-1,2-dihydropyrimidin-4-yl) amino) -2-oxyethyl) amino). The protection, inactivation, and curation activities of SN11 at a concentration of 500 mu g/mL against TMV in Nicotiana glutinosa were 82.6%, 84.2%, and 72.8%, respectively. SN11 also effectively suppressed the systemic transportation of a recombinant TMV carrying GFP reporter gene (p35S-30B:GFP) in Nicotiana benthamiana by reducing viral accumulation to 71.3% in the upper uninoculated leaves and inhibited the systemic infection of TMV in Nicotiana tabacum plants. Furthermore, the results of RNA-seq showed that compound SN11 induced differential expression of genes involved in the biogenesis and function of ribosome, plant hormone signal transduction, plant pathogen interaction, and chromatin. These results validate the antiviral mechanisms of the cytidine peptide compound and provide a theoretical basis for their potential application in the management of plant virus diseases.

Tomato yellow mottle-associated virus (TYMaV) belongs to the genus Cytorhabdovirus in the family Rhabdoviridae and has been reported to infect a variety of Solanaceae crops, such as Solanum lycopersicum, S. nigrum, Capsicum annuum and Nicotiana benthamiana (Li et al. 2022, Li et al. 2023, Xu et al. 2017, Zhou et al. 2019). In August 2022, about 500 out of 2000 tobacco (N. tabacum) plants showing leaf distortion, crinkling and mosaic symptoms were found in one tobacco growing field in Xingren City, Guizhou Province, China. To identify the causal pathogen(s), leaves from 20 symptomatic tobacco plants were collected and pooled to perform small RNA deep sequencing (sRNA-Seq) and assembly. Briefly, total RNA was extracted with TRIzol Reagent (Takara, Kusatsu, Japan). A small RNA cDNA library was constructed by the small RNA Sample Pre Kit. sRNA-Seq was performed with an Illumina NovaSeq 6000 platform. About 29 million reads were obtained and 334 contigs generated after removal of host-derived sequences. Among them, 31 unique contigs mapped to the TYMaV genome (NC_034240.1), covering 28.43% of the genome with the mean read coverage of 0.92%. Meanwhile, 226 contigs mapped to the genome of a potyvirus, chilli veinal mottle virus (ChiVMV, NC_005778.1), covering 88.79% of the genome with the mean read coverage of 0.83%. To verify the sRNA-Seq result for TYMaV identification, reverse transcription (RT)- PCR was performed with specific primers TYMaV-F (5'-CTGACGTAGTGTTGGCAGAT-3') and TYMaV-R (5'-AACCTCCATGCAGAACCATGG-3'). The expected-size 936-bp fragment was amplified from total RNA of all 20 samples. Dot enzyme-linked immunosorbent assays (Dot-ELISA) with antibody for TYMaV (kindly provided by Dr. Zhenggang Li from Guangdong Academy of Agricultural Sciences) were performed and further verified TYMaV infection. In addition, five asymptomatic tobacco plants from the same field as controls were used to detect TYMaV by RT-PCR and Dot-ELISA, and all samples showed negative test results. Subsequently, 17 primer pairs (Supplementary Table 1) were used to obtain the full-length sequence of TYMaV from a single positive tobacco sample by RT-PCR, followed by Sanger sequencing at Sangon Biotech (Shanghai, China). The resulting amplicon sequences were assembled into a nearly full-length genome sequence of a TYMaV isolate from tobacco in Guizhou (TYMaV-GZ). BLASTn analysis of the 13, 393 nt-long sequence (GeneBank accession number, PP444718) revealed 84.7% and 87.2% nt sequence identity with the TYMaV tomato isolate (KY075646.1) and the TYMaV S. nigrum isolate (MW527091.1), respectively. Moreover, five S. nigrum plants showing leaf crinkling and mosaic symptoms from tobacco fields tested positive for TYMaV by RT-PCR assay, suggesting a potential spread of TYMaV between tobacco and S. nigrum, which may serve as a reservoir for the virus in the tobacco fields. However, the transmission route of TYMaV remains unknown, and further verification is needed. To our knowledge, this is the first report of TYMaV infecting tobacco crop in China. It will be important to assess the potential economic importance of TYMaV to tobacco production in China and elsewhere, and to elucidate the respective roles of this virus and ChiVMV in the leaf distorting and yellowing symptoms.

Tomato (Solanum lycopersicum L.) is an important fruit and vegetable crop with high economic value due to its rich vitamins (Friedman. 2002). Over the past five years, due to tomato brown rugose fruit virus (ToBRFV) infection, the tomato production in many countries and regions in Asia, America and Europe have experienced declines in yield and quality (Salem et al. 2023). ToBRFV is a positive-sense single-stranded RNA virus of the genus Tobamovirus in the family Virgaviridae (Salem et al. 2016). In the field, ToBRFV mainly infects solanaceous crops, including tomato and pepper (Zhang et al. 2022). Symptoms on ToBRFV-infected tomato plants mainly include foliar mottle, vein necrosis, and brown mottled rugose fruit (Alfaro-Fernández et al. 2020, Hamborg et al. 2022, Ma et al. 2021). In April 2023, about 150 tomato plants showing leaf curl, brown patch, and rugose surface on fruits were found in a greenhouse grown with about 500 tomato plants in Huludao City, Liaoning province, China. Two leaves and eight fruits from each of 10 symptomatic tomato plants were sampled and subjected to dot enzyme-linked immunosorbent assay (Dot-ELISA) with an antibody against ToBRFV (LV BAO, Chengdu, China); and all samples tested positive. Sap inoculations were prepared from 0.1 g of ToBRFV-positive tomato leaves via homogenization with 0.01 mol·L-1 PBS (phosphate buffered saline, pH 7.2), which were then inoculated mechanically onto 10 tomato cv. Moneymaker and 10 Nicotiana benthamiana plants at four- to six-leaf stage, respectively. At 10 days post inoculation (dpi), the leaf curl symptoms of all tomato plants were shown, which were consistent with those on greenhouse-infected plants. At 5 dpi, the upper leaves of all N. benthamiana plants showed yellowing and curling symptoms. The results of Dot-ELISA assays revealed that these mechanically inoculated plants were positive for ToBRFV. Total RNAs of inoculated and greenhouse-collected samples were extracted using TRIzolTM reagent and analyzed by reverse-transcription (RT)-PCR with specific primers ToBRFV-FD (5' GTCCCGATGTCTGTAAGGCTTGC) and ToBRFV-RD (5' GCAGGTGCAGAGGACCATTGTAA) for ToBRFV detection, respectively. The results showed that a 680-bp fragment was obtained in all tested samples. Then, primers ToBRFV-F1 (5' GTGTATTTTTTACAACATATACC) and ToBRFV-R1 (5' AACCATTGACTCAGAACTC), ToBRFV-F2 (5' TAGCCAAGAATCACGCATG) and ToBRFV-R2 (5' AGCAGCAATAATCACCGTA), ToBRFV-F3 (GAAAGAGTGGGGACGTTACAACATTCATCGGTAAT) and ToBRFV-R3 (TGGGCCCCTACCGGGGGTTCCGGGGGAATTCGAAT) were used to amplify the full-length sequence of ToBRFV using field-collected samples. The methods of primer design are shown in supplemental file 1. The sequence obtained by Sanger sequencing showed 99.86% nucleotide (nt) identity with ToBRFV-SD isolate (accession no. MT018320.1) from Shandong province, China. The full-length sequence of ToBRFV was uploaded to GenBank database with the accession number OR437354. To our knowledge, this is the first report of ToBRFV infecting tomato in Northeast China.

The current methods for pest managements in cereal crops rely mainly on the applications of conventional chemicals, which are known to have low pest control efficiencies and are less environmentally friendly. The primary aim of this research endeavor was to devise a specific, efficient and eco-friendly biological agent capable of mitigating maize lethal necrosis (MLN), a viral disease that affected maize productivity and mainly caused by coinfection of maize chlorotic mottle virus (MCMV) and sugarcane mosaic virus (SCMV). Through this study, we have found that silencing Ferredoxin 3 (ZmFd3) expression in maize can significantly reduce the damages caused by MCMV and/or SCMV infections. Based on this finding, we have developed a liposome nanoparticles (LNPs)mediated nanotechnology to suppress MCMV and/or SCMV infections. Using this nanotechnology, we have confirmed that the cationic/anionic liposomes (CLPs and ALPs) can be used to package and promote ZmFd3dsRNA spread in maize plants. Through leaf spray, we have determined that the anti-MCMV and anti-SCMV activities of ZmFd3@CLPs and ZmFd3@ALPs nanoparticles can reach 52.46 similar to 79.83 % at 6 days post virus inoculation (dpi). Because ZmFd3 is involved in hypersensitive response (HR), and can interact with MCMV p7b and SCMV HC-Pro, we designed an FHP-dsRNA to target ZmFd3 , MCMV p7b , and SCMV HC-Pro transcripts for silencing in plants simultaneously. The result showed that both FHP@CLPs and FHP@ALPs nanoparticles can provide excellent, although short, protection to maize and sorghum plants to MCMV and SCMV infections. Overall, this study has developed a novel nanotechnology that can be used to mitigate virus infection in cereal crops through RNA interference (RNAi).

Maize chlorotic mottle virus (MCMV) is one of the main viruses causing significant losses in maize. N6-methyladenosine (m6A) RNA modification has been proven to play important regulatory roles in plant development and stress response. In this study, we found that MCMV infection significantly up-regulated the m6A level in maize, and methylated RNA immunoprecipitation sequencing (MeRIP-seq) and RNA sequencing (RNA-seq) were performed to investigate the distribution of m6A modified peaks and gene expression patterns in MCMV-infected maize plants. The results showed that 1325 differentially methylated genes (DMGs) and 47 differentially methylated and expressed genes (DMEGs) were identified and analyzed. Moreover, the results of virus-induced gene silencing (VIGS) assays showed that ZmECT18 and ZmGST31 were required for MCMV infection, while silencing of ZmMTC, ZmSCI1 or ZmTIP1 significantly promoted MCMV infection in maize. Our findings provided novel insights into the regulatory roles of m6A modification in maize response to MCMV infection.

MicroRNAs (miRNAs) are widely involved in various biological processes of plants and contribute to plant resistance against various pathogens. In this study, upon sugarcane mosaic virus (SCMV) infection, the accumulation of maize (Zea mays) miR398b (ZmmiR398b) was significantly reduced in resistant inbred line Chang7-2, while it was increased in susceptible inbred line Mo17. Degradome sequencing analysis coupled with transient co-expression assays revealed that ZmmiR398b can target Cu/Zn-superoxidase dismutase2 (ZmCSD2), ZmCSD4, and ZmCSD9 in vivo, of which the expression levels were all upregulated by SCMV infection in Chang7-2 and Mo17. Moreover, overexpressing ZmmiR398b (OE398b) exhibited increased susceptibility to SCMV infection, probably by increasing reactive oxygen species (ROS) accumulation, which were consistent with ZmCSD2/4/9-silenced maize plants. By contrast, silencing ZmmiR398b (STTM398b) through short tandem target mimic (STTM) technology enhanced maize resistance to SCMV infection and decreased ROS levels. Interestingly, copper (Cu)-gradient hydroponic experiments demonstrated that Cu deficiency promoted SCMV infection while Cu sufficiency inhibited SCMV infection by regulating accumulations of ZmmiR398b and ZmCSD2/4/9 in maize. These results revealed that manipulating the ZmmiR398b-ZmCSD2/4/9-ROS module provides a prospective strategy for developing SCMV-tolerant maize varieties.