<p>PDF file - 1026K, LDHA levels do not fluctuate after LDHB knockdown</p>

<p>PDF file - 663K, Glycolysis signature genes that correlate to LDHB expression in basal-like tumors</p>

PDF file - 257K, Animal weight change and tumor volume of individual xenograft tumors

XLSX file - 31K, Results from the RNAi screen and identification of hits

XLSX file - 25K, RNAi optimization and screening conditions

<p>PDF file - 95K</p>

<p>XLSX file - 59K, Genes that comprise the glycolysis and oxidative phosphorylation gene signatures</p>

PDF file - 663K, Glycolysis signature genes that correlate to LDHB expression in basal-like tumors

PDF file - 6626K, Validation of IHC antibody specificity for LDHB, LDHA, MCT1, and MCT4

The broad application of precision cancer immunotherapies is limited by the number of validated neoepitopes that are common among patients or tumor types. To expand the known repertoire of shared neoantigen-human leukocyte antigen (HLA) complexes, we developed a high-throughput platform that coupled an in vitro peptide-HLA binding assay with engineered cellular models expressing individual HLA alleles in combination with a concatenated transgene harboring 47 common cancer neoantigens. From more than 24,000 possible neoepitope-HLA combinations, biochemical and computational assessment yielded 844 unique candidates, of which 86 were verified after immunoprecipitation mass spectrometry analyses of engineered, monoallelic cell lines. To evaluate the potential for immunogenicity, we identified T cell receptors that recognized select neoepitope-HLA pairs and elicited a response after introduction into human T cells. These cellular systems and our data on therapeutically relevant neoepitopes in their HLA contexts will aid researchers studying antigen processing as well as neoepitope targeting therapies.

PDF file - 963K, Additional top targets from RNAi screen that are specifically required for triple negative breast cancer

<p>PDF file - 791K, mRNA expression profiles of lactate dehydrogenase enzymes in breast cancer subtypes</p>

Neurodegenerative diseases have been linked to a dysfunctional mitochondrial quality control system that is partially maintained by proteins PINK1 and Parkin. Whereas mitophagy pathways are becoming well-characterized, less is known about the molecular mechanisms of PINK1 trafficking in mitochondria. Accordingly, we have used a small molecule probe (MitoBloCK-10/MB-10) that modulates the activity of TIMM44, an essential component of the protein associated motor (PAM) complex for the mitochondrial inner membrane (TIM23) translocase, to characterize PINK1 import. MB-10 did not inhibit the import or degradation of PINK1 in energized mitochondria. However, when mitophagy was induced by the addition of an uncoupler or respiratory inhibitor, MB-10 treatment altered PINK1 trafficking by inhibiting association with the TOM complex and impairing Parkin recruitment and subsequent mitophagy. MB-10 analogs that did not inhibit TIMM44 activity failed to impair mitophagy, thereby assigning specificity to MB-10. Because PINK1 undergoes lateral release from the TIM23 translocon to interact with inner membrane (IM) modulators, our studies support that TIMM44 may be a key regulator and that the PAM complex has a central role in regulating PINK1-dependent mitophagy. Our studies also provide a probe for dissecting PINK1/Parkin events for mitochondria as well as studying PINK1-dependent mitophagy in cell and animal models.

The mitochondrial processing peptidase, MPP, resides in the mitochondrial matrix and has an essential role in cleaving the mitochondrial amino-terminal targeting sequence of a large cohort of precursors. Here we describe a chemical genetic screen to identify small molecules that modulate MPP activity. The screen used recombinant MPP and a fluorogenic peptide and yielded two small molecules with different scaffolds that inhibited MPP cleavage activity in vitro. The small molecules did not alter the mitochondrial membrane potential or interfere with respiration. In protein import studies with isolated yeast mitochondria, the import of precursors with cleavable and non-cleavable sequences was inhibited. The import of fumarase, which localizes to the matrix and cytosol, was also inhibited, suggests that the trafficking of dual-localized proteins can be manipulated with small molecules. Overexpression of MPP in yeast increased mitochondrial protein import, suggesting additional roles for MPP in mitochondrial biogenesis in addition to cleavage of the targeting sequence. In biochemical studies, MPP associated with the TIM23 translocon, the protein associated motor, and Complex III in yeast and mammalian cells. In zebrafish studies, the small molecules and knock-down of MPP gave a similar phenotype marked by a delay in pigmentation in addition to abnormal cardiac and somite development. The import of Pink1 was also inhibited, confirming a role for MPP in Pink1 maturation. These studies suggest that small molecule modulators for MPP can be useful for modulating mitochondrial stress pathways and this screen may be adapted to develop mitochondrial precursor-specific inhibitors for MPP.

Summary Strategies for maximizing the potency and specificity of cancer immunotherapies have sparked efforts to identify recurrent epitopes presented in the context of defined tumor-associated neoantigens. Discovering these “neoepitopes” can be difficult owing to the limited number of peptides that arise from a single point mutation, a low number of copies presented on the cell surface, and variable binding specificity of the human leukocyte antigen (HLA) class I complex. Due to these limitations, many discovery efforts focus on identifying neoepitopes from a small number of cancer neoantigens in the context of few HLA alleles. Here we describe a systematic workflow to characterize binding and presentation of neoepitopes derived from 47 shared cancer neoantigens in the context of 15 HLA alleles. Through the development of a high-throughput neoepitope-HLA binding assay, we surveyed 24,149 candidate neoepitope-HLA combinations resulting in 587 stable complexes. These data were supplemented by computational prediction that identified an additional 257 neoepitope-HLA pairs, resulting in a total of 844 unique combinations. We used these results to build sensitive targeted mass spectrometry assays to validate neoepitope presentation on a panel of HLA-I monoallelic cell lines engineered to express neoantigens of interest as a single polypeptide. Altogether, our analyses detected 84 unique neoepitope-HLA pairs derived from 37 shared cancer neoantigens and presented across 12 HLA alleles. We subsequently identified multiple TCRs which specifically recognized two of these neoantigen-HLA combinations. Finally, these novel TCRs were utilized to elicit a T cell response suggesting that these neoepitopes are likely to be immunogenic. Together these data represent a validated, extensive resource of therapeutically relevant neoepitopes and the HLA context in which they can be targeted.

Abstract Activating mutations in PIK3CA are among the most significant oncogenic events across all cancers, making it an important target for drug development. Yet the application of PI3K inhibitors in the clinic has been limited by the difficulty of achieving an adequate therapeutic window, due to the critical role that PI3K signaling plays in normal physiologic processes, such as glucose homeostasis. In theory, the therapeutic window could be improved if it were possible to design mutant selective inhibitors, as has been demonstrated with other oncogenes such as EGFR. However, unlike EGFR, the most predominant PIK3CA activating mutations do not reside in the kinase active site, presenting a major challenge for rational structure-based design. Nevertheless, it was recently shown that the PI3K inhibitor taselisib is able to achieve modest levels of mutant selectivity both across cancer lines as well as in cell lines that were engineered to express mutant or wild-type PIK3CA. Taselisib was also shown to selectively induce degradation of mutant versus wild-type PIK3CA, leading to the speculation that this degradation may be responsible for the observed selectivity. In order to better understand the origins of mutant selectivity for taselisib and several other PIK3CA inhibitors, we assessed these inhibitors in a variety of biophysical and biochemical assays under conditions designed to mimic physiologic settings. In parallel, we also investigated the mechanistic basis of this selectivity in our engineered cell lines. Our results are consistent with the hypothesis that selective degradation of mutant PIK3CA is the predominant mechanism underlying mutant selectivity for this class of PIK3CA active site inhibitors. This abstract is also being presented as Poster B03. Citation Format: Lan Nguyen, Kyle Edgar, Kyung Song, Stephen Schmidt, Victorai Schutz, Noriko Ishisoko, Eric Torres, Akash Das, Divya Murali, Steve Sideris, Timothy Wendorff, Matt Saabye, Hans Purkey, Jawahar Sudhamsu, Steven Staben, Emily Hanan, Georgia Hatzivassiliou, Lori Friedman, Nicholas F. Endres. Selective degradation of mutant PIK3CA promotes increased mutant specificity in a subset of PI3K ATP-competitive inhibitors [abstract]. In: Proceedings of the AACR Special Conference on Targeting PI3K/mTOR Signaling; 2018 Nov 30-Dec 8; Boston, MA. Philadelphia (PA): AACR; Mol Cancer Res 2020;18(10_Suppl):Abstract nr PR03.

We developed a strategy for identifying modulators of juxtacrine signaling, triggered by a cell-surface ligand displayed on synthetic lipid bilayers, via cognate receptors on apposed cells. Using readouts for receptor lateral transport and intracellular signaling, we screened a small interfering RNA (siRNA) library and identified specific receptor tyrosine kinases (RTKs) that directly or indirectly modulate apoptosis signaling by a model death ligand through its cognate death receptors. This approach may be broadly useful for studying juxtacrine cell-cell signaling systems.

The insulin/IGF-1 signalling pathway (ISP) plays a fundamental role in long term health in a range of organisms. Protein kinases including Akt and ERK are intimately involved in the ISP. To identify other kinases that may participate in this pathway or intersect with it in a regulatory manner, we performed a whole kinome (779 kinases) siRNA screen for positive or negative regulators of the ISP, using GLUT4 translocation to the cell surface as an output of for pathway activity. We identified PFKFB3, a positive regulator of glycolysis that is highly expressed in cancer cells and adipocytes, as a positive ISP regulator. Pharmacological inhibition of PFKFB3 suppressed insulinstimulated glucose uptake, GLUT4 translocation and Akt signalling in 3T3-L1 adipocytes. In contrast, overexpression of PFKFB3 in HEK293 cells potentiated insulindependent phosphorylation of Akt and Akt substrates. Furthermore, pharmacological modulation of glycolysis in 3T3-L1 adipocytes affected Akt phosphorylation. These data add to an emerging body of evidence that metabolism plays a central role in regulating numerous biological processes including the ISP. Our findings have important implications for diseases such as type 2 diabetes and cancer that are characterised by marked disruption of both metabolism and growth factor signalling. The insulin/IGF-1 signalling pathway (ISP) regulates a number of cellular processes, particularly those relating to metabolism including glucose transport, glycogen synthesis, protein http://www.jbc.org/cgi/doi/10.1074/jbc.M115.658815 The latest version is at JBC Papers in Press. Published on September 4, 2015 as Manuscript M115.658815 Copyright 2015 by The American Society for Biochemistry and Molecular Biology, Inc. PFKFB3 and insulin signalling 2 synthesis, lipid metabolism and gene expression (1). One of these processes specific to fat and muscle cells is the translocation of the glucose transporter GLUT4 to the plasma membrane (PM) to facilitate glucose uptake. This process is defective in metabolic diseases such as insulin resistance and type 2 diabetes (T2D). Insulin triggers GLUT4 translocation via the PI3K/Akt pathway, resulting in phosphorylation of downstream substrates including the Akt substrate AS160. In addition, a number of other protein kinases have been implicated in insulin action including Cdk5 (2,3), the G protein coupled receptor kinase 2 (GRK2) (4,5), Src family kinases (6,7), members of the PKC family (8) and JNK (9). To understand the role of protein kinases and phosphorylation in insulin action we recently performed global analysis of insulin-regulated protein phosphorylation in 3T3-L1 adipocytes. This identified changes in >5,000 phosphorylation sites in response to insulin (10). While this comprised substrates of Akt and other kinases known to play a role in insulin action, clearly there are many insulin-regulated substrates with no known kinase. In this study, we set out to identify additional kinases that regulate insulin action. We chose insulin regulation of GLUT4 translocation to the PM as our endpoint because this is one of the most complex and important actions of insulin and it is postulated to represent one of the earliest contributors to the development of insulin resistance (11). We established a novel GLUT4 translocation assay in HeLa cells, facilitating high throughput analysis. We then performed a global kinase screen using this system in combination with siRNA knockdown of all kinases in the human genome. This resulted in identification of ~300 kinases with a putative involvement in insulin action. Surprisingly there was an enrichment of kinases that play an important role in glucose metabolism. We next focused on one of these kinases, PFKFB3 (6-phosphofructo-2-kinase fructose-2,6-bisphosphatase 3). This enzyme regulates glycolysis through the production of fructose-2,6-bisphosphate (F2,6BP) (12) a potent allosteric activator of 6-phosphofructo-1-kinase (PFK-1) the rate-limiting step in glycolysis. Using a variety of pharmacological and genetic approaches we confirmed that PFKFB3 has an important role in insulin action. The mechanism for this effect involves a positive feedback regulation of glycolysis onto the Akt signalling pathway. These data have important implications for the Warburg effect in tumour cells. EXPERIMENTAL PROCEDURES Reagents, antibodies and constructs – General chemicals were purchased from Sigma unless otherwise stated. FCS, DMEM, antibiotics, glutamax, bicinchoninic acid (BCA) reagent and Supersignal West Pico chemiluminescent substrate were obtained from Thermo Scientific. BSA was purchased from Bovostar. Inhibitors were purchased from Calbiochem (3-(3-pyridinyl)-1-(4pyridinyl)-2-propen-1-one, 3PO), Thermo Scientific (α-cyano-,8-(1-phenylindol-3yl)acrylate, UK-5099). GPR81 agonists were from Calbiochem (3-Chloro-5-hydroxybenzoic acid, 3HBA) and Toronto Research Chemicals (3,5dihydroxybenzoic acid, 3,5-DHBA). Antibodies were purchased from Covance Research Products (HA), Sigma (FLAG, α-tubulin), Roche Applied Science (GFP), Santa Cruz Biotechnology (14-33), Cell Signalling Technology (pSer473-Akt, pThr308-Akt, Akt, pThr642-AS160, pThr246PRAS40, PRAS40, pSer235/236-S6, pThr389S6K, pSer21/9-GSKα/β, β-actin), Invitrogen (Alexa488-conjugated antibody), Rockland Immunochemicals (IRDye 700or 800-conjugated antibodies) GE Healthcare (HRP-conjugated antibodies) and Abgent (PFKFB3, N-terminal). The antibody against AS160 was previously described (13). Human PFKFB3 in pDEST47 was a gift from Charles Watt (Garvan Institute) and was originally derived from Open Biosystems clone (cat # MHS1010-9203644). PFKFB3 was subcloned into Gateway converted p3xFLAGCMV-10 (Sigma-Aldrich) using Gateway cloning (Clontech). Cell Culture and transfection – 3T3-L1 fibroblasts were obtained from Howard Green (14) and were cultured and differentiated to adipocytes as previously described (15). HA-GLUT4 retrovirus was produced using Plat-E cells and used for infection of 3T3-L1 cells as previously described (15). HEK293 cells were transfected with Flag-PFKFB3, PFKFB3 in pDEST47 or empty vector control p3xFLAG-CMV-10 or pEGFP-N1 (Clontech) using Lipofectamine 2000 (Thermo Scientific) according to the manufacturer’s instructions 48 h prior to PFKFB3 and insulin signalling 3 experiments. To establish the HA-GLUT4-HeLa cell line, HeLa cells were transfected with linearized HA-GLUT4 in pBABE-puro (15) using Fugene HD (Thermo Scientific) according to the manufacturer’s instructions. HeLa cell colonies stably expressing HA-GLUT4 were selected with 1 μg/ml puromycin and screened for GLUT4 expression and insulin-stimulated GLUT4 translocation to the PM. siRNA screen and HA-GLUT4 translocation assay – Reverse transfection was performed using Dharmafect1 and siGenome SMARTpool and On Target-plus pool and single oligo siRNAs (Dharmacon) in HA-GLUT4 HeLa cells in 96 well plates. Cells were incubated for 72 h after transfection before the GLUT4 translocation assay. Cells were serum-starved for 2 h, followed by incubation in the presence or absence of 100 ng/ml IGF-1 for 15 min, fixed and immunostained for surface (and total in secondary screen) HAGLUT4 as previously described (16). The assay was performed in duplicate 96-well plates per condition with controls on each plate amounting to a total of 10 plates in quadruplicates (duplicates of basal and IGF-1). Nuclei were stained with Hoechst nuclear stain. Fluorescence intensity was quantified using an IN Cell Analyzer 2000 (GE Healthcare). Images were collected at 20x magnification and 9 fields/well. Image and data analysis – Image analysis and processing was performed using IN Cell developer toolbox 1.8 to obtain fluorescence intensity of surface HA-GLUT4, normalised to cell number (Fig. 1A). Image processing involved object and intensity segmentation and post processing including binary sieving and erosion. Fluorescence intensity and area were determined for surface HA-GLUT4 staining and nuclei count for DAPI staining and the ratio of fluorescence intensity x area divided by nuclei was calculated. Z-scores were calculated for each plate independently. Mean and standard deviation (n=2) of the duplicates were calculated for raw values (fluorescence intensity x area / nuclei count) and z-scores. Z-score mean was used for filtering and selection for secondary screen. Lactate determination – Lactate efflux into the extracellular medium was determined as described previously (17). Cells were lysed in PBS containing 2% SDS and protein concentration determined by BCA assay and media lactate levels were normalised to protein content. For intracellular lactate measurements cells were washed twice with ice-cold PBS and quenched in a freezing cold solution of methanol and H2O. Metabolites were extracted with an equal volume of ice-cold chloroform, the supernatant was evaporated at 45°C and resuspended in H2O. Lactate was measured using a tetrazolium-coupled lactate assay (Patent US4254222) with modifications. Briefly, the sample was incubated with 2x reaction buffer (1.1 mM thiazolyl blue tetrazolium bromide, 0.45 mM phenazine methosulfate, 2.1 mM NAD, 39 IU/ml lactate dehydrogenase (Roche), 5.3 g/L glycine, 1.4% (v/v) Triton X-100). The reaction was incubated for 15 min in the dark at RT and absorbance was measured at 590 nm. Extracellular acidification rate (ECAR) – ECAR was measured using the Seahorse Bioanalyser XF24 system (Seahorse Biosciences). Cells growing in XF24 plates were incubated in buffer free DMEM for the duration of the experiment, with additions made by injection according to the manufacturer’s instructions. siRNA transfection in 3T3-L1 adipocytes – 3T3-L1 adipocytes were transfected with scrambled and PFKFB3 siRNA, as previously described (18). A pool of 4 siRNAs was used for PFKFB3 (#1 caacgaaagtgttcaatgttt, #2 ccaagaagctgactcgctatt, #3 gttctacgctgcctactagtt, #4 cgaattgtatactacctgatt) and one scrambled siRNA (gacttaactcatccaacgat

The insulin/insulin-like growth factor (IGF)-1 signaling pathway (ISP) plays a fundamental role in long term health in a range of organisms. Protein kinases including Akt and ERK are intimately involved in the ISP. To identify other kinases that may participate in this pathway or intersect with it in a regulatory manner, we performed a whole kinome (779 kinases) siRNA screen for positive or negative regulators of the ISP, using GLUT4 translocation to the cell surface as an output for pathway activity. We identified PFKFB3, a positive regulator of glycolysis that is highly expressed in cancer cells and adipocytes, as a positive ISP regulator. Pharmacological inhibition of PFKFB3 suppressed insulin-stimulated glucose uptake, GLUT4 translocation, and Akt signaling in 3T3-L1 adipocytes. In contrast, overexpression of PFKFB3 in HEK293 cells potentiated insulin-dependent phosphorylation of Akt and Akt substrates. Furthermore, pharmacological modulation of glycolysis in 3T3-L1 adipocytes affected Akt phosphorylation. These data add to an emerging body of evidence that metabolism plays a central role in regulating numerous biological processes including the ISP. Our findings have important implications for diseases such as type 2 diabetes and cancer that are characterized by marked disruption of both metabolism and growth factor signaling.

The spliceosome machinery is composed of multimeric protein complexes that generate a diverse repertoire of mRNA through coordinated splicing of heteronuclear RNAs. While somatic mutations in spliceosome components have been discovered in several cancer types, the molecular bases and consequences of spliceosome aberrations in cancer are poorly understood. Here we report for the first time that PRPF6, a member of the tri-snRNP (small ribonucleoprotein) spliceosome complex, drives cancer proliferation by preferential splicing of genes associated with growth regulation. Inhibition of PRPF6 and other tri-snRNP complex proteins, but not other snRNP spliceosome complexes, selectively abrogated growth in cancer cells with high tri-snRNP levels. High-resolution transcriptome analyses revealed that reduced PRPF6 alters the constitutive and alternative splicing of a discrete number of genes, including an oncogenic isoform of the ZAK kinase. These findings implicate an essential role for PRPF6 in cancer via splicing of distinct growth-related gene products.