Background/Objectives: Osteosarcoma (OS) is an aggressive bone malignancy with a complex tumor microenvironment (TME) that influences therapeutic outcomes and resistance. How neoadjuvant chemotherapy (NACT) reshapes the OS TME at single-cell resolution remains largely undefined. This study aimed to characterize cellular heterogeneity in the OS TME after NACT and identify chemokine-mediated intercellular crosstalk driving chemoresistance. Methods: Single-cell RNA sequencing was performed on surgical specimens from 12 OS patients (6 treatment-naive and 6 post-NACT). After quality control, 77,616 cells (36,214 from naive patients, 41,402 from post-NACT samples) were analyzed through the Seurat pipeline. Unsupervised clustering, differential expression analysis, and cell–cell communication network construction were performed, and candidate signaling axes were validated using transwell assays and Western blotting. Results: Cells were classified into 10 major cell types. Osteoblasts, identified as malignant cells, were partitioned into 11 subpopulations with marked transcriptional heterogeneity and differential PI3K/Akt pathway activity. Post-NACT, stromal and vascular components underwent molecular and functional remodeling, shaping an immune-activated microenvironment. Mononuclear phagocytes resolved into three discrete clusters—monocytes, macrophages, and dendritic cells—with differentiation gradients. Endothelial cells maintained robust CXCL2 expression throughout the therapeutic course. Functional validation via transwell assays and Western blotting confirmed that endothelial-derived CXCL2 promoted macrophage chemotaxis via CXCR2, with corresponding CXCR2 upregulation in macrophages. Conclusions: Collectively, these findings suggest the complex cellular and transcriptional heterogeneity of the OS microenvironment and its chemokine-driven molecular remodeling after NACT, indicating that TME dynamics may be a determinant of therapeutic response and chemoresistance.
Canagliflozin reduces albuminuria in patients with diabetic kidney disease (DKD) beyond its glucose-lowering effect, but the mechanisms remain unclear. We analyzed 85 patients treated with canagliflozin and 85 controls over 26 weeks to explore whether the gut microbiome and its metabolites contribute to renoprotection. Canagliflozin remodeled the gut microbiota, notably enriching Roseburia intestinalis and increasing plasma melibiose levels. In mice, canagliflozin alleviated glomerular endothelial injury and albuminuria. Similar effects were replicated by fecal microbiota transplantation, Roseburia intestinalis, or melibiose administration. Mechanistically, melibiose bound to and activated glyoxalase 1, reduced methylglyoxal, and suppressed the AGE-RAGE pathway, preserving glomerular endothelial integrity. Furthermore, oral melibiose precursor supplementation reduced albuminuria in patients with early-stage DKD. These findings suggest the involvement of a gut-kidney axis in the renoprotective effects of canagliflozin and indicate that melibiose may serve as a potential therapeutic strategy for DKD.
OBJECTIVE: This study analyzed the frequency and patterns of pediatric neurological disorders and investigated changes in the inpatient disease spectrum following the COVID-19 pandemic. METHODS: A retrospective analysis was conducted on 2,981 children admitted to the Department of Neurology at the Seventh Medical Center of PLA General Hospital in Beijing, China, between January 2019 and December 2024. RESULTS: According to the ICD-10 criteria, the most common diagnoses were “nervous system diseases” (39.74%) and “mental and behavioral disorders” (31.98%). The pandemic led to a significant increase in the proportion of inpatients with mental and behavioral disorders, whereas the proportion of hospitalizations for nervous system diseases among all pediatric neurology admissions decreased. Furthermore, an increase in the number of autism spectrum disorder (ASD) inpatients was observed starting in 2022, with a more notable increase from 2023 to 2024. CONCLUSION: This study provides detailed insights into shifts in the inpatient disease spectrum of pediatric neurology from 2019 to 2024. These findings, which are based on hospitalized patients, highlight changes in healthcare utilization patterns and may inform hospital resource planning. These findings provide a foundation for future research that incorporates outpatient data to understand the pandemic’s impact on pediatric neurological disorders.
Hyperuricaemia, a metabolic disorder, is characterized by abnormally elevated serum uric acid (SUA) levels. Fructose-1,6-bisphosphatase (FBPase), a key rate-limiting enzyme in gluconeogenesis, catalyses the irreversible conversion of fructose-1,6-bisphosphate (F-1,6-BP) to fructose-6-phosphate (F-6-P). In humans, FBPase deficiency disorder (OMIM #229700) is an autosomal recessive inborn error of metabolism characterized by fasting-induced hypoglycaemia, life-threatening lactic acidosis, hyperuricaemia, and hepatosteatosis. However, the exact pathophysiological mechanisms driving hyperuricaemia remain unknown. To systematically investigate the regulatory role of FBPase in urate homeostasis, we developed in vitro models encompassing major metabolic tissues—HK-2 cells (kidney), LoVo/Caco-2 cells (intestinal epithelium) and HepG2 cells (liver). Our results demonstrate that FBP1 ablation markedly downregulates ABCG2 protein expression in renal (HK-2) and intestinal (LoVo/Caco-2) epithelial cells, thereby inducing a hyperuricaemic-prone metabolic state. Notably, in HepG2 cells, FBP1 deficiency unexpectedly led to reduced intracellular urate accumulation, indicating an inverse phenotype. Mechanistically, FBP1 sustained uric acid homeostasis through the orchestration of the PI3K/AKT/CREB signalling axis, driving functional ABCG2 expression. In summary, FBP1 plays a crucial role in uric acid metabolism, and its reduction leads to impaired uric acid excretion, consequently causing hyperuricaemia.
Pathogenic/likely pathogenic variants (P/LPVs) in DNA damage response (DDR) genes are known ovarian cancer (OC) risk factors, but gene-specific risk estimates in Han Chinese remain unclear. To accurately assess the risk associated with DDR genes in the Han Chinese population to facilitate personalized risk management and enhance clinical decision-making. We performed next-generation sequencing of 45 DDR genes in 666 OC patients from Henan, China. Associations between P/LPVs and clinical features were assessed using chi-squared tests. Variant frequencies were compared with population controls (gnomAD and ChinaMAP databases) to estimate gene-specific odds ratios (ORs) using Fisher’s test. In Henan Ovarian Cancer patients, the median disease onset age was 53 years (range: 24–81), with 7.7
BackgroundPublic health emergencies such as COVID-19 severely disrupt drug supply chains, creating sudden surges in demand, labor shortages, and regulatory challenges. Existing studies often focus on single supply chain stages, with limited systematic analysis of policy responses across the entire cycle.ObjectivesThis study aims to systematically analyze China's emergency drug supply policies by examining issuing agencies, developmental stages, policy tools, and supply chain links, to identify patterns, complementarities, and existing gaps.MethodsA total of 559 policy texts (110 national, 449 provincial) issued between December 2019 and February 2023 were collected. Content analysis and coding were conducted based on a four-dimensional framework. Social network analysis was applied to joint policy issuances to assess institutional collaboration and centrality.ResultsNational policies emphasized macro-level planning and dynamic adjustment: motivation and symbolic tools dominated in the burst stage, commands and regulations in the remission stage, and symbolic tools in later stages. Provincial policies relied more on rigid enforcement through commands and regulations, gradually shifting toward capacity-building in distribution and use. Finance, healthcare security, and regulatory agencies emerged as network hubs, while the distribution stage received the most policy support. Raw material supply was largely overlooked.ConclusionsNational and provincial policies demonstrated complementary functions-national policies providing strategic direction and provincial policies ensuring operational enforcement. However, imbalances in policy tool use, weak shortage monitoring, and insufficient human resource policies remain. Future research should incorporate municipal-level measures, field-based evaluations, and international comparisons to optimize China's emergency drug supply governance.
N1-methyladenosine (m1A) modification widely occurs in various RNAs, yet its pathophysiological function in tumorigenesis remains poorly understood. Notably, the expression and biological roles of tRNA m1A methyltransferase 6 noncatalytic subunit (TRMT6) in breast cancer, particularly in triple-negative breast cancer (TNBC), are unknown. Herein, it is demonstrated that TRMT6 is markedly elevated in TNBC, due to the H3K4me3 methylation modification occurring at the promoter region to enhance transcription. Through integrated analyses of m1A tRNA methylated RNA immunoprecipitation sequencing, ribosome profiling sequencing, RNA sequencing and data-independent acquisition mass spectrometry, ferritin heavy chain 1 (FTH1) is identified as a downstream target of TRMT6. Mechanistically, it is found that TRMT6 is responsible for the formation of m1A methylation on tRNAs, which increases the translation efficiency of FTH1. Besides, TRMT6 promotes ferritin light chain (FTL) expression at both transcriptional and translational levels, further reinforcing its role in iron metabolism. TRMT6 regulates the malignant progression of TNBC by modulating ferroptosis in tumor cells. Conclusively, the findings indicate that histone methylation-driven TRMT6 is crucial for the translation of FTH1 and FTL, which bridges the understanding of m1A tRNA modification and ferroptosis. These results highlight TRMT6 as a novel potential therapeutic target for TNBC.
Radiotherapy (RT) can induce an in situ vaccine effect by promoting the generation of tumor neoantigens, yet this effect is insufficient to elicit robust antitumor immune responses. Although the abundant tumor-associated macrophages (TAMs) in tumor tissue, as members of antigen-presenting cells, have been shown to capture antigens efficiently, the proteomic analysis, that TAMs is demonstrated exhibit up-regulated cysteine protease in lysosomes that leads to tumor antigen degradation. Inhibiting cysteine protease activity can promote the antigen-presenting of TAMs. Based on this, a nanomodulator (Ft-E64/Hf@Lipo) is developed, combining radiosensitizer hafnium (Hf) and the cysteine protease inhibitor E64, which cooperatively reinvigorated the antigen presentation of TAMs. Ft-E64/Hf@Lipo sensitized RT generated abundant tumor neoantigens, and then E64/antigens, along with the apoptotic tumor cells, trafficked to TAMs via efferocytosis. The reprogrammed TAMs with attenuated lysosomal function effectively presented tumor antigens and activated CD8+ T cells. In vivo studies demonstrated that the nanomodulator significantly enhanced systemic antitumor immune responses following RT, realizing excellent therapeutic efficacy against large, treatment-resistant CT26 tumors in combination with anti-PD-1 therapy. The work provides a promising approach for enhancing the in situ vaccine effect of RT to improve its clinical benefits.
AimsBased on cross-sectional and follow-up data, we aimed to explore the continuous long-term pattern of beta-cell function change in type 2 diabetes and to analyze the relevant influencing factors.Materials and methodsData from 2898 type 2 diabetic subjects were retrospectively analyzed. Islet beta-cell function was evaluated by the homeostasis model assessed index (HOMA-β). The pattern of association between HOMA-β and disease duration coverup of 50 years were explored using non-linear regression approaches. Findings were replicated in longitudinal follow-up data from multi-centers. Influencing factors of both residual HOMA-β level and HOMA-β decline rate were investigated.ResultsWe identified a model including three clear phases of HOMA-β change: an initial ascending phase over 4.2 years from diagnosis (3.34% change per year [95%CI 0.04, 6.52]), followed by a phase of exponential fall up to 20.9 years from diagnosis (-3.04% change per year [95%CI -3.78, -2.29]) and thereafter a low and plateau phase (0.17% change per year [95% CI -0.72, 1.05]). Longitudinal follow-up data verified this model. Higher BMI (OR = 1.103 [95%CI 1.047, 1.161]), UA (OR = 1.003 [95%CI 1.001, 1.005]), metabolic Syndrome (OR = 1.526 [95%CI 1.021, 2.279]) and lower HbA1c (OR = 0.695 [95%CI 0.627, 0.771]) levels were independently associated with higher residual HOMA-β level. Earlier diagnosis (Coefficient=0.0009 [95%CI 0.0002, 0.0016]) was independently associated with faster HOMA-β decline.ConclusionsBeta-cell function change in the course of type 2 diabetes was nonlinear with multi-phases. Targeting the factors that affect different phases would contribute to the protection of the disease progression.
The use of medication in the neonatal intensive care unit (NICU) is a complex field that requires special attention, as neonatal patients may have different sensitivities and responses to drugs than adults and older children. The administration of medication in the NICU must consider various factors, including the dosage of the medication, the route of administration, monitoring, and potential drug interactions. In this study, we conducted a retrospective analysis of medication use in the neonatal intensive care unit of 122 preterm infants treated in our hospital from 2020 to 2023. Correlation analysis revealed that among perinatal clinical characteristics, birth weight was moderately positively correlated with gestational age, with a correlation coefficient greater than that of birth weight with the Apgar score. The top 3 medication types in the NICU were “vitamins, nutritional drugs, enzyme preparations and drugs that regulate water, electrolytes, and acid-base balance”, “blood hematopoietic system medications”, and “antimicrobial medications”. From 2020 to 2023, the most commonly used drugs in the NICU were vitamin AD (vitamin A and vitamin D) drops and calcium gluconate injections. In addition, we demonstrated that the most commonly prescribed off-label drugs were vitamins, water and electrolyte balance nutrition drugs, and blood circulation system drugs. Our retrospective study will not only help identify and evaluate interventions to reduce medication errors but also aid healthcare systems and providers in understanding, implementing, and enhancing these interventions to improve the safety and quality of care for newborns. Nonetheless, further research is needed to assess the relative cost-effectiveness of various medication safety interventions to facilitate their adoption and implementation in the decision-making process.
ABSTRACT Esophageal cancer (EC) is a multifaceted disease. Our understanding of the involvement of esophageal microbiota in its pathogenesis and progression is limited, which is due to the lack of proper endoscopic sampling methods. Hereby, we conducted a comparative analysis of paired samples obtained through endoscopic brushing and cytosponge, aiming at assessing the feasibility of using cytosponge as a minimally invasive sampling way for studying esophageal microbiota. Our findings suggest that cytosponge sampling yielded significantly superior community richness and diversity compared to endoscopic brushing in both controls (non-cancerous) and EC individuals. The analysis of beta-diversity revealed distinct microbial community pattern in the genus diversity between the two sampling methods, underscoring the importance of selecting appropriate sampling methods to effectively characterize the esophageal microbiota. Specifically, Lactococcus and Serratia showed higher abundance in the samples collected by endoscopic brushing, while Alloprevotella and Leptotrichia were more enriched in the samples collected by cytosponge. These differences in dominant microbes were associated with metabolic pathways that particularly were related to host inflammation, such as pyruvate and glucose metabolisms. Notably, the phylogenetic levels of the microbiota indicated varied explanatory power for different detection purposes. This study underscores the substantial impact of sampling method selection on the acquisition of esophageal microbiota associated with the EC development, encompassing considerations of both abundance and diversity. This highlights the significance of selecting an appropriate sampling method for investigating the esophageal microbial status and studying the micro-environment in EC-related individuals. IMPORTANCE This study addresses a critical issue in esophageal cancer study by comparing two different sampling methods, endoscopic brushing and cytosponge, for investigating the esophageal microbiota. Our work highlights the suitability of the cytosponge technique as a minimally invasive sampling method for studying the esophageal microbiota and emphasizes the importance of selecting an appropriate sampling method to characterize the microbial community. Our findings have significant implications for advancing the understanding of the role of the esophageal microbiota in cancer development and will inform future research and clinical approaches in this field.
Radiotherapy is used in the treatment of approximate to 50% of patients with cancer. However, tumor repopulation is a major cause of treatment failure after radiotherapy. It is observed that apoptotic tumor following ionizing radiation (IR) accelerated the growth of surviving tumor cells. Here a Gasdermin E and Tannic acid-based nanoassembly (GT) loaded with manganese tetroxide (Mn3O4) (termed as Mn3O4@GT) is developed to suppress tumor repopulation and improve the treatment outcome of radiotherapy. Mn3O4@GT enables an increase in the reactive oxygen species accumulation in tumor cells, enhancing radiotherapy-mediated tumor killing. What's more, it can hijack activated caspase 3 to induce tumor pyroptosis, reversing apoptosis-mediated tumor repopulation. In vivo results shows that Mn3O4@GT significantly reduced the IR induced tumor repopulation by 2.7 fold, resulting in 92% complete regression of tumors. In addition, Mn3O4@GT can sensitize tumors to anti-PD-L1 therapy by inducing immunogenic pyroptosis with 85% regression of distant tumors. The caspase 3-hijacking nanosystem holds a great potential for improving the clinical benefits of radiotherapy. Apoptotic tumor cells following radiotherapy produce potent growth-stimulating signals to stimulate tumor proliferation. After systematic administration of Mn3O4@GT, it serves as a radiosensitizer to amplify reactive oxygen species production and enhance DNA damage. And meanwhile, Gasdermin E hijacks activates caspase-3 to induce tumor pyroptosis, bypassing apoptosis-mediated tumor repopulation and thus improving the therapeutic benefits of radiotherapy. image
Purpose To gain an in-depth and comprehensive understanding of Chinese organ transplant recipients’ perceptions, expectations, and suggestions of pharmacy services to hospital pharmacists. Methods This qualitative study was conducted in central China, from February to December 2020. Participants were collected with a purposive and snowball sampling method. Focus group discussions were conducted with organ transplant recipients and content analysis was applied to identify themes and subthemes. Results 21 recipients participated in the qualitative study. Four themes and thirteen subthemes were identified: (1) perceptions of clinical pharmacists and pharmacy services; (2) expectations for pharmacy service content; (3) expectations for pharmacy service form; and (4) difficulties as a special group. Conclusion The pharmacy services provided by Chinese healthcare institutions are inadequate to meet the needs of organ transplant recipients. However, the acceptance and expectation of pharmacy services by transplant recipients are high. Therefore, China should learn from the experience of developed countries and focus on the actual needs of patients to establish a better pharmacy service system for organ transplantation.
Esophageal cancer (EC) is an aggressive malignancy with a poor prognosis. Various factors, including dietary habits, and antacid and antibiotic use, have been shown to influence the esophageal microbiome. Conversely, enrichment and diversity of the esophageal microbiome can also impact its function. Recent studies have revealed prevalent changes in the esophageal microbiome among patients with EC, thus suggesting the potential contribution of the esophageal microbiome to EC development. Additionally, distinct microbiome compositions have been observed in patients with different responses to radiotherapy and chemotherapy, indicating the role of the esophageal microbiome in modulating treatment outcomes. In this review, we have examined previous studies on the esophageal microbiome in healthy individuals and patients with EC or other esophageal diseases, with a focus on identifying microbial communities associated with EC pathogenesis and prognosis. Understanding the role of the microbiome in EC may aid in early detection and optimized treatment strategies, ultimately leading to better outcomes for patients.
Abstract Background Lung adenocarcinoma (LUAD) is the most predominant histological subtype of lung cancer characterized by driver mutations detected in a substantial proportion of the cases. Tyrosine kinase inhibitors (TKIs) are standard care for the patients with these mutations. In this study, we evaluated the efficiency of an NGS-based 8-gene test in selecting TKIs-sensitive patients in a cohort of treatment-naive Chinese LUAD patients and evaluated the sensitivity of rare compound mutations to different EGFR-TKIs in vitro. Material and methods Targeted sequencing covering the hotspot regions of eight LUAD driver genes was performed across 853 treatment-naive LUAD patients admitted in Henan Cancer Hospital (HNCH cohort). The mutational landscape of HNCH patients was compared with TCGA patients. Logistic regression analysis was used to determine the factors associated with presence of these mutations. Genetically modified LUAD PC9 cells were established to evaluate the sensitivity of selected EGFR rare compound mutations to different EGFR-TKIs. Results A total of 574 single nucleotide variants (SNVs), 270 indels, 88 amplifications, and 87 rearrangements were identified in this study, with EGFR and KRAS being the most frequently mutated genes. Females, mostly life-long non-smokers, had significantly higher EGFR mutation rates than males. Males, primarily smokers, more frequently had KRAS mutations. HNCH patients in general had a higher mutation count than TCGA patients (1.09 vs 0.93 mutations per patient (m/p)), in consistent with its higher proportion of patients with advanced disease. Rare EGFR compound mutations identified in this study, including Exon19del plus L747S/I744V and L858R plus V843I/T854A/G873, conferred genetically modified PC9 cells more sensitive to second-generation EGFR-TKI afatinib in-vivo. Conclusion This NGS-based 8-gene test efficiently identified over 70% of Chinese treatment-naive LUAD patients who are targetable for TKIs. Patients with rare EGFR compound mutations might consider second-generation EGFR-TKIs for treatment.
The human genome contains 90 genes that encode either receptor or non-receptor tyrosine kinases, most of which are historically oncogenes activated by mutations, amplifications, in-frame indels, or rearrangements.1 Rearrangement of tyrosine kinases, which are often fused with a dimerization domain-containing fusion partner, is a potent mechanism for constitutive kinase activation that causes uncontrolled cell proliferation and is found in a variety of tumors. However, the rearrangement of the vascular endothelial growth factor receptor (VEGFR) family has never been reported in cancer, which may indicate that the obstruction of neoangiogenesis, which is critical for tumor development and requires VEGFRs' involvement, poses a significant obstacle for tumor cells to overcome. Here, we describe a de novo acute myeloid leukemia (AML) case in which a translocation between chromosome 3q12 and chromosome 13q12 leads to a gene fusion between FLT1 (also known as VEGFR1) and CMSS1 (Cms1 ribosomal small subunit homolog). The resulting chimeric protein contains an N-terminal fragment from CMSS1 and the intact tyrosine kinase domain of FLT1. CMSS1::FLT1 is cytoplasmic, constitutively activated, and promotes cell proliferation. In vitro cell models with forced expression of CMSS1::FLT1 were sensitive to an FLT1 kinase inhibitor Axitinib. A 79-year-old female patient presented with decreased WBC. Physical examination revealed no bruising or organomegaly. The complete blood counts showed WBC 1.8 × 109/L, Hb 105 g/L, MCV 109.2 fL, PLT 213 × 109/L, 3% blasts, 38.6% neutrophils, 47.5% lymphocytes, 13.3% monocytes, 0.6% eosinophils, and 0% basophils. Bone marrow aspirate smear revealed 21% of variably sized blasts with cytoplasmic pseudopod formation and 1–3 nucleoli. The myeloid elements were decreased and exhibited left-shift maturation, with some cells containing increased cytoplasmic granules. Erythroblasts were significantly increased, with some binucleated erythroblasts. Occasional erythrocytes with Howell–Jolly bodies were observed (Figure 1A). The myeloid to erythroid ratio was 0.35:1. Cytochemical analysis of blast cells was negative for myeloperoxidase (MPO) and periodic acid–Schiff (PAS). Bone marrow flow cytometry revealed 28% of CD34+ cells that were CD13+, CD33+, CD34+, CD38dim, CD117+, CD200+, HLADRdim, CD2−, cyCD3−, CD5−, CD7−, CD11b−, CD14−, CD16−, CD19−, CD56−, cyCD79−, and MPO−. The diagnosis of AML was made. Cytogenetic analysis showed a complex rearrangement between chromosome 3 and 13 as the sole change (46,XX,der(3)t(3;13)(q12;q12)inv(3)(p25q11.2),der(13)t(3;13)[10]/46,XX[10]) (Figure 1B). A targeted DNA-NGS assay of 128 leukemia-related genes identified BCORL1 p.A427Dfs17 (VAF 10.6%) and ETV6 p.R103Sfs9 (10.4%). CNV analysis revealed no apparent chromosome gain or loss. A targeted RNA-NGS assay with bait probes covering 81 leukemia-related genes did not find any fusion transcript. After obtaining the patient's informed consent and approval from our local Institutional Review Board (IRB), we performed a genome-wide mate-pair DNA sequencing, which revealed DNA fusion fragments consistent with the chromosome breakpoints seen by karyotype analysis, containing intron 1 of CMSS1 at 3q12 and intron 15 of FLT1 at 13q12 (Figure 1C). The expression of the CMSS1::FLT1 fusion transcript was confirmed by a RT-PCR assay with primers specific to CMSS1 (CMSS1_F1: TACCCGTGATGTTCTGC; CMSS1_F2 nest: TCGAGACCTGAGCTGAAA) and FLT1 (FLT1_R1: ACTTGCTGGCATCATAAG; FLT1_R2 nest: GAAGACCTTTTCATTTTTCGG), which showed two distinct bands in an agarose gel electrophoresis (Figure 1D). Sanger sequencing of the major band showed an in-frame fusion between CMSS1 exon 1 and FLT1 exon 16. The predicted chimeric protein contains an N-terminal fragment from CMSS1 and the entire tyrosine kinase domain from FLT1. The minor band consisted of CMSS1 exon 1, a 50 bp CMSS1 intronic sequence from intron 1, and FLT1 exon 16 (Figure 1E), which is likely from differential splicing because a classic acceptor splicing signal "AG" and a donor splicing signaling "GT" were observed at the 5′ and 3′ end of the inserted intronic fragment, respectively. The minor transcript is likely nonfunctional due to a shifted reading frame. A lentivirus carrying an MYC-tagged CMSS1::FLT1 was introduced into NIH3T3 cells. The subcellular localization of CMSS1::FLT1 was determined using immunofluorescence staining with an anti-MYC antibody, which revealed predominant cytoplasmic localization (Figure 1F). An immunoprecipitation of CMSS1::FLT1 was performed with MYC antibody, which showed a band corresponding to the expected size of CMSS1::FLT1 (72 Kd). Upon stripping and incubating with an anti-phospho-tyrosine antibody, the CMSS1::FLT1 was tyrosine phosphorylated (Figure 1G). In addition, MAPK, a known downstream target of FLT1 activation, is also phosphorylated (Figure 1H). These results are consistent with a ligand-independent kinase activation of the CMSS1::FLT1. CMSS1::FLT1-expressing cells showed significantly faster growth compared to cells expressing an empty vector, as determined by the Cell Counting Kit-8 (CCK-8) assay (Figure 1I). In contrast, cells expressing CMSS1::FLT1 were significantly more sensitive to treatment with Axitinib, an FLT1/VEGFR1 kinase inhibitor (Figure 1J). The VEGFR family comprises three members: FLT1 or VEGFR1, kinase insert domain receptor (KDR) or VEGFR2, and FLT4 or VEGFR3. These tyrosine kinase receptors possess seven immunoglobulin (Ig)-like extracellular domains, a transmembrane domain, and an intracellular split tyrosine kinase domain. Both FLT1 and KDR are predominantly expressed in vascular endothelial cells, while FLT1 is also expressed in monocytes and macrophages.2 FLT4 is mainly expressed in lymphatic endothelial cells. During embryonic development, FLT1 and KDR are required for angiogenesis and vasculogenesis, with KDR being the main signaling transducer and FLT1 a major regulator of VEGFA (ligand) levels. FLT4 plays a crucial role in lymphatic vessel development. Recent studies indicate that all three VEGFRs are important for neoangiogenesis in tumors. VEGFR amplification, activation mutation, and overexpression have been observed in various tumors, including lung adenocarcinoma, colon adenocarcinoma, melanoma, glioma, and endometrial endometrioid adenocarcinoma.3 FLT1 has been implicated in tumor metastasis by promoting the recruitment and activation of macrophages in the tumor microenvironment. FLT1 activation on macrophages can result in the secretion of cytokines and growth factors that promote tumor growth and invasion, as well as the recruitment of additional macrophages to the tumor site. FLT1 signaling on tumor cells can also contribute to metastasis by promoting the development of a pre-metastatic niche and enhancing tumor cell migration and invasion. In a mouse model expressing a deficient FLT1 with its tyrosine kinase domain deleted, highly metastatic 3LL-LLC lung cancer cells failed to produce lung metastasis. Macrophages with a tyrosine kinase-deficient FLT1 lost the capability of cell migration when induced by VEGF.4 While FLT1 is well known for its role in angiogenesis and tumor metastasis, the function of CMSS1 is unclear. RNA-Seq expression data from GTEx showed a ubiquitous expression pattern of CMSS1 in 53 different human tissues. Immunofluorescence staining with a CMSS1-specific antibody showed bright nucleoli staining in A-431, U2-OS, and U-251 MG cells (The Human Protein Atlas), consistent with an RNA-binding protein. RNA-binding proteins are important for hematopoiesis. Notably, the expression levels of 6 RNA-binding proteins, including CMSS1, reliably distinguished low-risk from high-risk patients with diffuse large B-cell lymphoma (DLBCL).5 Since dimerization is an important feature of RNA-binding proteins, it is likely that CMSS1 provides a dimerization motif for the CMSS1::FLT1 fusion protein, resulting in a ligand-independent dimerization and constitutive kinase activation of FLT1. The cellular signaling of FLT1 is not well-defined yet, however, PLCγ-PKC-MAPK signaling is required for VEGFA/KDR-induced endothelial proliferation. KDR 1175Y is phosphorylated when activated, which serves as a docking site for PLCγ. The PLC-γ then stimulates hydrolysis of phosphatidylinositol (PIP2), leading to protein kinase C (PKC) activation and subsequent raf-1/MAPK activation. Since FLT1 shares the same KDR 1175Y motif, a similar PLCγ-PKC-MAPK signaling likely contributes to the oncogenesis of CMSS1::FLT1.6 The activation of tyrosine kinase receptors is an important pathway implicated in the oncogenesis of myeloid neoplasms. Specifically, FLT3 is altered in roughly a quarter of AML cases. In myeloid/lymphoid neoplasms characterized by eosinophilia, rearrangements involve PDGFRA/B, FGFR1, JAK2, FLT3, and ABL1. Notably, tyrosine kinase inhibitors can successfully treat patients with these genetic anomalies. Our studies have shown that cells expressing CMSS1::FLT1 are sensitive to the tyrosine kinase inhibitor Axitinib, which targets VEGFRs and PDGFRs and is FDA-approved for advanced renal cell carcinoma. Additionally, inhibitors that target the PLCγPKC-MAPK signaling pathway, such as the PKC inhibitor Midostaurin and MAPK inhibitor Ulixertinib, may also be helpful. In summary, we reported the first documented case of cancer with VEGFR rearrangement, resulting in the activation of FLT1 signaling. Notably, these tumor cells are sensitive to the FLT1 inhibitor. Although this fusion is rare, it provides a unique opportunity to explore the downstream FLT1 signaling pathway, which plays a crucial role in angiogenesis and tumor metastasis. Xiaoshan Yang, Lingfeng Liu, and Xiaojun Chen performed experiments. Liying Zhang, Bingzong Li, and Yu Sun provided CNL patient samples and clinical data. Yu Sun and Sheng Xiao analyzed the data. Sheng Xiao, Hong Zhang, and Jun Li commented on the paper. Xiaoshan Yang and Sheng Xiao wrote the paper. Yu Sun and Sheng Xiao designed the research. All authors contributed to writing the paper by providing guidance and comments on its content. The authors declare no conflict of interest. The data that support the findings of this study are available from the correspondingauthor upon reasonable request.
Objective As lifelong learners, hospital pharmacists must continually improve their self-directed learning skills. Reasonable learning strategies have been proven to enhance self-directed learning (SDL) significantly. Therefore, this study aims to investigate the SDL strategies used by hospital pharmacists in depth to provide them with a reference for the development of their SDL skills.Setting The study was conducted in three tertiary hospitals in Henan, China.Design and participants This study employed a multicentre qualitative design and lasted 12 months. One-on-one interviews and focus group discussions were used to collect data. All interviews were transcribed verbatim, and the interview data were analysed using the thematic analysis method. Purposive sampling was used to select interviewees (n=17) from three tertiary hospitals in Henan province in central China.Results After conducting data analysis, we summarised 12 learning strategies related to SDL, which were grouped into four themes: use of information resources, application of cognitive strategies, development of learning plans and use of learning platforms.Conclusion The findings suggest that classic learning strategies, such as cognitive strategies and the development of learning plans, remain the cornerstones of hospital pharmacists’ SDL abilities, while contemporary advances in information technology and changes in learning concepts have enriched the learning resources and learning platforms that are available to hospital pharmacists and have confronted contemporary hospital pharmacists with certain challenges.
As homologous recombination deficiency (HRD) is a biomarker to predict the efficiency of PARP inhibitor treatment, this study developed a non-exonic single-nucleotide polymorphism (SNP)-based targeted next-generation sequencing panel and comprehensively examined it both on standard and clinical ovarian cancer tissues. The HRD scores calculated by the panel and whole-genome sequencing were consistent, with the analysis by sequenza being the most reliable. The results on clinical samples revealed that the panel performed better in HRD analysis compared with the SNP microarray. There are several distinctions between this newly developed kit and reported HRD detection panels. First, the panel covers only 52 592 SNPs, which makes it capable of detecting genomic instability. Secondly, all the SNPs are non-exonic; as a result, the panel can be used cooperatively with any exon panel. Thirdly, all the SNPs selected have a high minor allele frequency in Chinese people, making it a better choice for HRD detection in Chinese patients. In summary, this panel shows promise as a clinical application to guide PARP inhibitors or platinum drugs used in the treatment of ovarian and other cancers.
Radiotherapy is a mainstay treatment for malignant tumors in clinical practice. However, enhancing radiation damage to tumor cells meanwhile sparing normal tissues is still a great challenge in radiotherapy. Nanomaterials with high atomic number (Z) values are promising radiosensitizers by promoting the radiation energy deposition in irradiated tumor cells, thus enhancing the therapeutic ratio of radiotherapy. In this review, we described the mechanisms of high-Z element based-radiosensitizers and systematically summarized the recent progress on high-Z metal-based nanomaterials, including high-Z metal-based nanoparticles, high-Z metal-based nanoscale metal-organic frameworks and high-Z metal-doping nanomaterials. Finally, further potential and challenges in this field were discussed.
Purpose: Diabetes mellitus is a serious health problem worldwide, and diabetic nephropathy is the complication. The diabetic nephropathy considerably enhances the oxidative stress, glycation, lipid parameters and inflammatory reaction. Ellipticine has potent free radical scavenging and anti-inflammatory effect.Methods: In the current study, our objectives were to thoroughly examine the renal protective effects of ellipticine in a rat model of streptozotocin (STZ)-induced diabetic nephropathy (DN) and to elucidate the underlying mechanisms involved. For the induction of diabetic nephropathy, streptozotocin (50 mg/kg) was used, and rats were separated into groups and given varying doses of ellipticine (2.5, 5 and 7.5 mg/kg). The body weight, and renal weight were estimated. The inflammatory cytokines, renal biomarkers, inflammatory antioxidant, and urine parameters were estimated. Results: Result showed that ellipticine considerably enhanced the body weight and reduced the renal tissue weight. Ellipticine treatment significantly (P < 0.001) repressed the level of blood urea nitrogen, serum creatinine, uric acid, blood glucose and altered the lipid parameters. Ellipticine significantly (P < 0.001) repressed the level of malonaldehyde and boosted the glutathione, catalase, superoxide dismutase, and glutathione peroxidase. Ellipticine treatment significantly (P < 0.001) reduced the inflammatory cytokines and inflammatory mediators. Conclusion: Ellipticine could be a renal protective drug via attenuating the inflammatory reaction, fibrosis and oxidative stress in streptozotocin induced rats.