Genetic engineering (GE) and gene editing may endow traits to trees such as increased biomass and the production of novel biomaterials. Long-lived organisms such as trees might be subject to biotechnology-related risks that could be different than those of annual row crops. Those risks could be relevant to production in engineered plantations and beyond plantations to natural forests. Therefore, appropriate risk regulation is important to assure biosafety of commercialized engineered trees. In addition to gene flow via sexual reproduction, vegetative reproduction might play an additional role in environmental “exposure” risk relative to transgene dispersal in GE tree plantations. While vegetative reproduction is beneficial for preserving desired genetic traits during tree propagation, it may lead to proximal clonal spread in the field. Although the environmental risks associated with vegetative reproduction of GE trees are recognized in commercial forestry, there are few field-based environmental risk assessment (ERA) studies on dispersal risks of self-propagated GE trees. GE or gene editing of target genes involved in the vegetative propagation processes may be useful to mitigate environmental risks of clonal spread through vegetative reproduction. This review provides updates for recent field test results of GE and gene edited trees. Gene candidates related to vegetative reproduction including adventitious shooting (AS) and adventitious rooting (AR) are discussed herein as a means to mitigate unintended clonal spread from GE tree plantations.

Land plants demonstrate high tolerance to acute ionizing radiation compared to other metazoans. However, few studies have analyzed plant gene expression in response to low-dose ionizing radiation. The present study performed two different sets of transcriptomic analysis of acutely exposed potato plants to 0.5–5 Gy of gamma radiation. In the first experiment, a total of 4,955 genes were differentially expressed in treated versus control plants. Among them, the gene expression of thirty-five genes were proportionally increased in a dose dependent manner. GO terms of these genes was enriched in DNA repair and metabolism related gene categories. Treatments caused no observable phenotypic effect until six weeks post-treatment, when apical growth aberrations led to an increase in lateral branching that corresponded with the total dose of gamma radiation. A second experiment analyzed the effect of shorter-duration exposures over the same dose range. While the shorter-duration exposures led to increased differentially expressed genes, thirty-one out of thirty-five genes identified in the first analysis were consistently expressed in this experiment. Also, the gene expression of these gene groups was reduced to baseline levels after recovery, indicating these genes are specific responsive genes against IR stress. Taken together, we identified DNA repair and metabolism related genes that were expressed at 1 Gy of gamma radiation. These findings are important for future biotechnological studies to improve stress tolerance in plants, as well as, in the design of advanced potato phytosensors to report gamma radiation injuries.

A major challenge in crop improvement is enhancing resistance to diverse biotic stresses. Because terpenoids play key roles in chemical defense, an envisioned strategy is to introduce new terpene metabolic pathways into crops through engineering. Microbial-type terpene synthase-like (MTPSL) genes are widespread in nonseed plants but absent in seed plants. Here, we engineered terpene metabolism in Nicotiana benthamiana using MTPSL genes, enabling production of sesquiterpenes absent in flowering plants and enhanced resistance to pest insects and fungal pathogens. Two liverwort MTPSL genes, RlMTPSL3 and RlMTPSL4, which produce sesquiterpenes absent from flowering plants, were selected for metabolic engineering. In N. benthamiana, both genes generated sesquiterpenes consistent with their in vitro activities, and co-expression yielded combined profiles. Co-expression of RlMTPSL3 and RlMTPSL4, individually or together, with 3-hydroxy-3-methylglutaryl-CoA reductase, the rate-limiting enzyme in sesquiterpene pathway, substantially increased sesquiterpene production. Bioassays of engineered tissues with two defoliating herbivores beet armyworm (Spodoptera exigua) and Colorado potato beetle (Leptinotarsa decemlineata) showed growth suppression and up to 30% mortality. The gut microbiome of beet armyworm feeding on engineered tissues showed differences from those feeding on control tissues, suggesting a potential mechanism underlying reduced pest insect performance. Engineered sesquiterpenes were recovered from larval frass, indicating stability through digestion. Transformed leaves emitted elevated sesquiterpenes as volatiles that repelled beet armyworm. In addition, extracts of engineered tissues inhibited the growth of Fusarium oxysporum, a fungal pathogen, by ∼50%. Together, these results demonstrate that MTPSL-based engineering can introduce new sesquiterpenes into flowering plants, providing a promising strategy for broad-spectrum crop protection.

Transcriptional repression is a fundamental regulatory mechanism that enables precise control of gene expression in response to developmental signals and environmental stimuli. Synthetic biology can leverage this process within plants to engineer programmable transgene repression systems. This review examines strategies for harnessing prokaryotic repressors in eukaryotic systems to develop synthetic repression systems in plants. These systems utilize modular promoter and repressor architectures that can be tuned through operator placement and repression-domain fusion, respectively, to adjust transcriptional regulation. Chemically dependent inducibility can also be introduced either through use of native derepression mechanisms of the prokaryotic repressors or the incorporation of ligand-binding domains. Finally, this review explores key challenges in designing synthetic repression systems, including kinetics constraints, balancing ON and OFF states, and differences between transient and transgenic expression contexts. Overall, this review highlights modular design frameworks for tunable transgene expression in plants.

Soybean NAC genes GmNAC19 and GmGRAB1 are root-preferential expressed genes whose overexpression led to enhanced root growth and/or tolerance to dehydration stress in transgenic soybean plants. Soybean (Glycine max) is one of the most important crops globally. Water shortage stress is a major abiotic factor limiting soybean growth and production. NAC transcription factors play important roles in plant development and stress responses. To date, numerous soybean NAC genes for plant growth and stress tolerance were identified. Yet, the functionality of the vast majority of them remains unknown. We previously identified soybean NAC genes GmNAC19 and GmGRAB1 whose overexpression enhanced root growth and/or dehydration tolerance in transgenic soybean hairy root system. Here, we examined the functionality of these genes through transgenic overexpression in homozygous T3 soybean lines. The endogenous expression analyses showed detectable levels of expression for both genes in leaf, stem, and root tissues with the highest levels in roots, suggesting their importance in roots. Under non-stress conditions, GmNAC19- and GmGRAB1-overexpressing plants had up to 1.7-fold increase in root length and/or 1.3-fold increase in root fresh/dry weight. There was a positive association between the level of increasing GmNAC19 and GmGRAB1 expression and root growth in the transgenic plants. The transgenic plants with improved root growth also produced higher seed yield by 1.5-fold than control plants, suggesting a positive impact of the increased root growth on seed production. Furthermore, GmNAC19-overexpressing plants showed an improved survival rate under water-deficit stress. The present study provides further insights into the potential applications of these NAC genes for development of improved soybeans.

Switchgrass (Panicum virgatum) is a promising lignocellulosic biofuel crop for which biomass and processing quality are important. Inherent plant variability across genotypes and environments challenges uniformity and product quality. In this study, the impact of nitrogen (N) application on switchgrass yield and quality was examined under field conditions using a highly diverse switchgrass panel over a 4-year period at Knoxville, TN. Overall, biomass production was correlated between low (0 kg of added N/ha) and moderate (135 kg of added N/ha) nitrogen treatments, suggesting that the N impact is largely uniform across the genotypes. Nonetheless, high biomass genotypes were identified with high nitrogen-use efficiency ; biomass was congruent or even higher (up to 9-fold) in the low N treatment. Genotypes were also identified with up to 94

Soybean (Glycine max) is the most widely grown legume crop in the world, providing important economic value. Pest herbivory damage by insects and mammalian wildlife, in particular the white-tailed deer (Odocoileus virginianus), limits yields in soybean. Incorporating trypsin inhibitors (TIs) as plant protectant against herbivory pests has been of interest. We previously showed that the overexpression of soybean TIs in soybean conferred insect deterrence under greenhouse experiments. In this study, we examined the potential of transgenic TI-overexpressing lines in deterring insects under field conditions at Knoxville, Tennessee. Our results indicate that the overexpression of TI could lead to a significant reduction in leaf defoliation of the transgenic compared to non-transgenic lines without negatively impacting plant growth and yield under field conditions. Furthermore, we extended our study by comprehensive evaluation of these transgenic plants against the white-tailed deer herbivory in a separate field setting at Jackson, Tennessee, and with controlled deer feeding experiments. No significant differences in growth characteristics were found between transgenic and non-transgenic lines under field conditions. There were also no significant differences in deer deterrence between transgenic and non-transgenic lines in ambient deer herbivory field or controlled deer feeding trials. Our study provides further insights into more exploration of the role of TI genes in pest control in this economically important crop.

The soybean gene GmSABP2-1 encodes methyl salicylate esterase and its overexpression led to significant reduction in development of pathogenic soybean cyst nematode. Soybean cyst nematode (SCN, Heterodera glycines) is one of the most devastating pests of soybean (Glycine max L. Merr.). In searching for SCN-defense genes, a soybean gene of the methylesterase (MES) family was found to be upregulated in an SCN-resistant soybean line and downregulated in an SCN-susceptible line upon SCN infection. This gene was designated as GmSABP2-1. Here, we report on biochemical and overexpression studies of GmSABP2-1 to examine its possible function in SCN resistance. The protein encoded by GmSABP2-1 is closely related to known methyl salicylate esterases. To determine the biochemical function of GmSABP2-1, a full-length cDNA of GmSABP2-1 was cloned into a protein expression vector and expressed in Escherichia coli. The resulting recombinant GmSABP2-1 was demonstrated to catalyze the demethylation of methyl salicylate. The biochemical properties of GmSABP2-1 were determined. Its apparent Km value was 46.2 ± 2.2 μM for methyl salicylate, comparable to those of the known methyl salicylate esterases. To explore the biological significance of GmSABP2-1 in soybean defense against SCN, we first overexpressed GmSABP2-1 in transgenic hairy roots of an SCN-susceptible soybean line. When infected with SCN, GmSABP2-1-overexpressing hairy roots showed 84.5

Plants and microbes communicate to collaborate to stop pests, scavenge nutrients, and react to environmental change. Microbiota consisting of thousands of species interact with each other and plants using a large chemical language that is interpreted by complex regulatory networks. In this work, we develop modular interkingdom communication channels, enabling bacteria to convey environmental stimuli to plants. We introduce a “sender device” in Pseudomonas putida and Klebsiella pneumoniae , that produces the small molecule p -coumaroyl-homoserine lactone (pC-HSL) when the output of a sensor or circuit turns on. This molecule triggers a “receiver device” in the plant to activate gene expression. We validate this system in Arabidopsis thaliana and Solanum tuberosum (potato) grown hydroponically and in soil, demonstrating its modularity by swapping bacteria that process different stimuli, including IPTG, aTc and arsenic. Programmable communication channels between bacteria and plants will enable microbial sentinels to transmit information to crops and provide the building blocks for designing artificial consortia.

circle With the rapid development of new breeding techniques, the ecological impacts of transgenic plants receive wide concern again, particularly for potential gene flow from transgenic crops to their relatives. The transgene insertion position, number of gene copies, and flanking sequence of exogenous genes integrated into the recipient genome affect the genetic stability and fitness of offspring. circle We employed hybrids F-1 and F-2, six backcross generations BC1-BC6 and BC1F1 from transgenic Brassica napus with Bacillus thuringiensis (Bt) cry1Ac gene and its wild relative B. juncea through hand pollination. We detected exogenous gene copies, mRNA transcription, and protein expression by ddPCR, qRT-PCR and ELISA, and the fitness of hybrid and backcross generations. circle Exogenous genes followed Mendelian segregation expectations in hybrid and backcrossed generations, with stable gene copies, mRNA transcription and protein concentration of exogenous genes in offspring. Exogenous gene copies had no significant effects on plant fitness, but had positive effects on mRNA transcription and protein concentration that varied with growth stages in hybrid and backcross generations. circle Our study demonstrated inheritance and ecological effects of exogenous genes from transgenic plants to wild relatives, which will help ecological risk management of biotechnological plants released in the nature.

In this study, three insect-resistant transgenic Bacillus thuringiensis (Bt) oilseed rape events (GT1, GT5 and GT9) under field conditions were utilised to analyse the dynamics of Cry1Ac protein and the changes in soil enzyme activities in the rhizosphere soil of transgenic Bt plants during different growth stages over two successive cultivation years. The results indicated that compared to the non-transgenic control plant cv. Westar, the amount of Cry1Ac protein in the rhizosphere soil of the three transgenic oilseed rape events was significantly higher during the flowering and podding stages in the first cultivation year. Additionally, in the second cultivation year, transgenic GT1 and GT9 had significantly higher amounts of Cry1Ac protein in the rhizosphere soil during the flowering stage, and all three transgenic oilseed rape events had significantly higher amounts of Cry1Ac protein in the rhizosphere soil during the podding stage. Over the two successive cultivation years, the sucrase activity in the rhizosphere soil of transgenic events showed significant changes during bolting, flowering and podding stages, while all three transgenic events exhibited significant changes in phosphatase activity during the four different stages. Furthermore, different transgenic events showed varying significant changes in urease and protease activities during the bolting, flowering and podding stages of the first year, and all three transgenic events had significant changes in dehydrogenase activities during the four different stages of the second cultivation year. PCA and correlation analysis clearly demonstrated a strong correlation between the Cry1Ac protein and five soil enzyme activities, as well as a close interconnectedness among those five soil enzyme activities. These findings suggest that the amount of insecticidal crystal proteins in the rhizosphere soil of transgenic Bt (Cry1Ac) oilseed rape varies with different growth periods, and the enzyme activities in the rhizosphere soil of transgenic Bt oilseed rape plants undergo significant changes over two successive planting years.

Switchgrass (Panicum virgatum L.) is a North American grass species with biofuel potential. Claviceps spp. is known to infect the florets of various grass species, initially characterized by a sticky honeydew exudate and later as sclerotium replacing the seed in the infected ovary (Tanaka et al 2023). Since 2019, from July to October, switchgrass panicles in Georgia have been observed with honeydew and black sclerotia. The disease was first noted on some of the 285 accessions of the genome-wide association study (GWAS) panels at the University of Georgia's Iron Horse Farm in Watkinsville and Gibbs Farm in Tifton, GA. In Watkinsville, GA, ergot incidence was 5%, 6%, 65% and 54% in 2019, 2020, 2021 and 2022, respectively. Symptomatic panicles with honeydew and sclerotia were collected in 2021 (sample Scl) and 2023 (samples Cla_M and ATH20cl) from Watkinsville, GA. Under microcopy, panicles with honeydew symptoms had mycelium and conidia (9 μm long [range of 5-13 μm] and 4 μm wide [3-5 μm]) consistent with Claviceps spp. (Tooley et al. 2001). Sclerotia were 1.5 mm long (range 1-3 mm). Sclerotia were surface sterilized for 3 minutes in 5% NaOCl, followed by 70% ethanol then rinsed three times in distilled water. Sterilized sclerotia were plated on potato dextrose agar and placed on bench top with a 12-hour day/night cycle at room temperature (22°C) (Singh 1976). After 2 months, the sclerotia produced sterile apothecia. For molecular identification, genomic DNA was extracted from three honeydew samples following the protocol of Doyle and Doyle (1987). The internal transcribed spacer (ITS) region and RNA polymerase second largest subunit (RPB2) gene were amplified using ITS4/ITS5 (White et al. 1990) and 5F2/7CR (Liu et al. 1999) primer sets. The ITS region of ATH20cl, Cla_M, and Scl (GenBank nos. PP546317- PP546319) showed 92.83-97.48% identity to C. clavispora (NR_163506.1). The RPB2 region of ATH20cl, Cla_M, and Scl (GenBank nos. PP573916- PP573918) showed 97.46-97.72% identity to C. clavispora (LT216566.1). The maximum likelihood tree constructed in MEGA-X (Kumar et al. 2018) using concatenated ITS (539 bp) and RPB2 (792 bp) gene sequences from this study and eleven reference sequences from Tanaka et al. (2023), revealed close relatedness of ATH20cl, Cla_M, and Scl to C. clavispora under section Pusillae. The pathogenicity test for samples ATH20cl and Cla_M was conducted in the greenhouse on switchgrass cultivar 'Alamo' grown in injection molded pots containing Sungro professional growing mix. Three replicates plants at reproductive (R3) growth stage were inoculated by immersing panicles in 105 spores/ml suspension for 5 minutes and bagged for 3 days (Tooley et al. 2001). Control plants were immersed in distilled water. Honeydew symptoms and sclerotia appeared within 7- and 90-days post-inoculation, respectively, whereas control plants remained symptom-free. The honeydew collected from the infected Alamo panicles were reconfirmed to produce similar spores to those collected from the field. This is the first report of ergot caused by C. clavispora in switchgrass. Ergot was also observed since 2019 on some accessions from the same GWAS panel planted at the University of Tennessee Plant Sciences Farm in Knoxville, TN. This information will be beneficial to determine the effect of ergot on biomass production and seed quality of switchgrass in the southeastern U.S.

Adaptation to abiotic stress is critical for the survival of perennial tree species. Salinity affects plant growth and productivity by interfering with major biosynthetic processes. Detrimental effects of salinity may vary between different plant tissues and cell types. However, spatial molecular mechanisms controlling plant responses to salinity stress are not yet thoroughly understood in perennial trees. We used laser capture microdissection in clones of Populus tremula x alba to isolate palisade and vascular cells of intermediary leaf from plants exposed to 150 mM NaCl for 10 days, followed by a recovery period. Cell-specific changes in proteins and metabolites were determined. Salinity induced a vascular-specific accumulation of proteins associated with photorespiration, and the accumulation of serine, 3-phosphoglycerate and NH4 + suggesting changes in N metabolism. Accumulation of the GLUTAMINE SYNTHETASE 2 protein, and increased GS1.1 gene expression, indicated that NH4 + produced in photorespiration was assimilated to glutamine, the main amino acid translocated in Populus trees. Further analysis of total soluble proteins in stems and roots showed the accumulation of bark storage proteins induced by the salinity treatments. Collectively, our results suggest that the salt-induced photorespiration in vascular cells mediates N-reallocation in Populus, an essential process for the adaptation of trees to adverse conditions.

Scientists who manage research laboratories often face ethical dilemmas related to conflicts between their different roles, such as researcher, mentor, entrepreneur, and manager. It is not known how often uncertainty about conflicting role obligations leads scientists to engage in unethical conduct, but this probably occurs more often than many people would like to think. In this paper, we reflect on ethical decision-making in scientific laboratory management with special attention to how different roles create conflicting obligations and expectations that may produce moral uncertainty and lead to violations of research norms, especially when combined with self-interest and other factors that increase the risk of misbehavior. We also offer some suggestions and guidance for investigators and research institutions.

Key message Water deficit-inducible synthetic promoters, SD9-2 and SD18-1, designed for use in the dicot poplar, are functional in the monocot crop, rice.

A robust agroinfiltration-mediated transient gene expression method for soybean leaves was developed. Plant genotype, developmental stage and leaf age, surfactant, and Agrobacterium culture conditions are important for successful agroinfiltration. Agroinfiltration of Nicotiana benthamiana has emerged as a workhorse transient assay for plant biotechnology and synthetic biology to test the performance of gene constructs in dicot leaves. While effective, it is nonetheless often desirable to assay transgene constructs directly in crop species. To that end, we innovated a substantially robust agroinfiltration method for Glycine max (soybean), the most widely grown dicot crop plant in the world. Several factors were found to be relevant to successful soybean leaf agroinfiltration, including genotype, surfactant, developmental stage, and Agrobacterium strain and culture medium. Our optimized protocol involved a multi-step Agrobacterium culturing process with appropriate expression vectors, Silwet L-77 as the surfactant, selection of fully expanded leaves in the VC or V1 stage of growth, and 5 min of vacuum at − 85 kPa followed by a dark incubation period before plants were returned to normal growth conditions. Using this method, young soybean leaves of two lines—V17-0799DT, and TN16-5004—were high expressors for GUS, two co-expressed fluorescent protein genes, and the RUBY reporter product, betalain. This work not only represents a new research tool for soybean biotechnology, but also indicates critical parameters for guiding agroinfiltration optimization for other crop species. We speculate that leaf developmental stage might be the most critical factor for successful agroinfiltration.

Site-specific recombination (SSR) systems have been extensively used for controlled genome modification in eukaryotic cells, especially for DNA excision and DNA site-specific integration. Unidirectional SSR systems are particularly attractive for efficient site-specific gene integration because of their irreversible recombination activities. Bxb1-att is one such unidirectional SSR system, which has emerged as a molecular tool for eukaryotic genome manipulation. We will review the discovery, development, and current applications of the Bxb1-att system with an emphasis on utility in plants. We provide perspectives on future applications using dual integrase cassette exchange for precise gene integration at a specific locus. Finally, potential applications of combining unidirectional SSR systems with newly developed genome-editing tools (e.g., CRISPR-Cas9) will be explored to enhance capabilities for precise locus-specific gene integration into plant genomes.

The impact of water-deficit (WD) stress on plant metabolism has been predominantly studied at the whole tissue level. However, plant tissues are made of several distinct cell types with unique and differentiated functions, which limits whole tissue ‘omics’-based studies to determine only an averaged molecular signature arising from multiple cell types. Advancements in spatial omics technologies provide an opportunity to understand the molecular mechanisms underlying plant responses to WD stress at distinct cell-type levels. Here, we studied the spatiotemporal metabolic responses of two poplar (Populus tremula× P. alba) leaf cell types -palisade and vascular cells- to WD stress using matrix-assisted laser desorption/ionization-mass spectrometry imaging (MALDI-MSI). We identified unique WD stress-mediated metabolic shifts in each leaf cell type when exposed to early and prolonged WD stresses and recovery from stress. During water-limited conditions, flavonoids and phenolic metabolites were exclusively accumulated in leaf palisade cells. However, vascular cells mainly accumulated sugars and fatty acids during stress and recovery conditions, respectively, highlighting the functional divergence of leaf cell types in response to WD stress. By comparing our MALDI-MSI metabolic data with whole leaf tissue gas chromatography-mass spectrometry (GC-MS)-based metabolic profile, we identified only a few metabolites including monosaccharides, hexose phosphates, and palmitic acid that showed a similar accumulation trend at both cell-type and whole leaf tissue levels. Overall, this work highlights the potential of the MSI approach to complement the whole tissue-based metabolomics techniques and provides a novel spatiotemporal understanding of plant metabolic responses to WD stress. This will help engineer specific metabolic pathways at a cellular level in strategic perennial trees like poplars to help withstand future aberrations in environmental conditions and to increase bioenergy sustainability.

Synthetic promoters may be designed using short cis-regulatory elements (CREs) and core promoter sequences for specific purposes. We identified novel conserved DNA motifs from the promoter sequences of leaf palisade and vascular cell type-specific expressed genes in water-deficit stressed poplar (Populus tremula x Populus alba), collected through low-input RNA-seq analysis using laser capture microdissection. Hexamerized sequences of four conserved 20-base motifs were inserted into each synthetic promoter construct. Two of these synthetic promoters (Syn2 and Syn3) induced GFP in transformed poplar mesophyll protoplasts incubated in 0.5 M mannitol solution. To identify effect of length and sequence from a valuable 20 base motif, 5 ' and 3 ' regions from a basic sequence (GTTAACTTCAGGGCCTGTGG) of Syn3 were hexamerized to generate two shorter synthetic promoters, Syn3-10b-1 (5 ': GTTAACTTCA) and Syn3-10b-2 (3 ': GGGCCTGTGG). These promoters' activities were compared with Syn3 in plants. Syn3 and Syn3-10b-1 were specifically induced in transient agroinfiltrated Nicotiana benthamiana leaves in water cessation for 3 days. In stable transgenic poplar, Syn3 presented as a constitutive promoter but had the highest activity in leaves. Syn3-10b-1 had stronger induction in green tissues under water-deficit stress conditions than mock control. Therefore, a synthetic promoter containing the 5 ' sequence of Syn3 endowed both tissue-specificity and water-deficit inducibility in transgenic poplar, whereas the 3 ' sequence did not. Consequently, we have added two new synthetic promoters to the poplar engineering toolkit: Syn3-10b-1, a green tissue-specific and water-deficit stress-induced promoter, and Syn3, a green tissue-preferential constitutive promoter.