The modulation of immune responses and tissue regeneration by postbiotics is a rapidly advancing area in skin care. Here, we show that whole-cell postbiotics derived from Bifidobacterium breve, Limosilactobacillus reuteri, and Ligilactobacillus salivarius, along with nicotinamide (NAM), enhance keratinocyte growth, differentiation, and skin epithelial barrier integrity in ex vivo human skin, as determined by electrical impedance spectroscopy (EIS), multiomics, and machine learning. B. breve promoted keratinocyte differentiation and suppressed inflammatory pathways, while L. reuteri and L. salivarius primarily reduced inflammatory pathways. Although NAM downregulated keratinocyte differentiation, it exerted anti-inflammatory effects. Machine learning analyses linked EIS changes to certain genes, highlighting strain-specific mechanisms. In addition, B. breve, L. reuteri, and NAM mitigated a common skin cleanser-induced skin epithelial damage, further supporting their therapeutic potential. In conclusion, integrating skin barrier measurements with omics and machine learning enabled the dissection of essential anti-inflammatory and keratinocyte differentiation mechanisms and genes of a strengthened skin barrier.

BACKGROUND:Eosinophilic esophagitis (EoE) is a chronic immune-mediated disease characterized by symptoms of esophageal dysfunction, such as dysphagia and food impaction, as well as eosinophilic inflammation and impaired epithelial barrier integrity, which promotes allergen influx. Environmental exposures that weaken the esophageal barrier, including surfactants found in personal care products such as sodium dodecyl sulfate (SDS) and cocamidopropyl betaine (CAPB), have been proposed as contributors to disease susceptibility. However, their direct effects on esophageal epithelial barrier function and associated molecular responses remain insufficiently characterized. METHODS:We investigated the molecular and functional consequences of SDS and CAPB exposure in primary EoE-derived esophageal organoids and air-liquid interface cultures derived from biopsy tissue samples. We conducted transepithelial electrical resistance (TEER) measurements, paracellular flux assays, RNA sequencing, targeted and untargeted proteomics, and immunofluorescence imaging. RESULTS:Treatment of esophageal organoids with SDS or CAPB (0-100 μg/mL) caused dose-dependent cytotoxicity and barrier disruption, with SDS producing stronger effects. At 12.5 μg/mL, viability declined to ~30% with SDS versus ~60% with CAPB, accompanied by greater TEER reduction and ~2-fold higher permeability. RNA-seq of organoids exposed to 12.5 μg/mL for 24 h showed distinct transcriptomic clustering, with 2749 shared and > 1500 surfactant-specific differentially expressed genes, indicating broad epithelial remodeling, cell-cycle suppression, and stress responses, more pronounced under SDS. SDS preferentially activated inflammatory and innate immune pathways, which was supported by proteomic detection of elevated cytokines (TNF, IL-8, IL-18, etc.). Both surfactants induced keratinization, epidermal cell differentiation, and partial epithelial-mesenchymal transition signatures, including increased vimentin without E-cadherin loss. CONCLUSION:These findings demonstrate that common surfactants can induce coordinated epithelial stress responses in esophageal tissue models and may act as environmental aggravating factors in EoE at relatively low doses. This work underscores the need to consider mucosal exposure to consumer product ingredients in the context of epithelial barrier disorders, particularly surfactants such as SDS and CAPB, and supports efforts to refine formulations to minimize epithelial damage.

T helper 1 (Th1) cell activation is an essential process for immune responses and is tightly regulated, including the prenylation of proteins critical for T cell function. Prenylation facilitates membrane association and protein function and, according to current consensus, is confined to C-terminal prenylation motifs. However, the full extent of the prenylated proteome, a broader understanding of prenylation sites, and the effects of inhibiting prenylation or blocking isoprenoid synthesis using statins remain incompletely understood. To address these gaps, we aimed to comprehensively identify and characterise protein prenylation in Th1 cells. Using a click chemistry-based enrichment approach followed by mass spectrometry in primary in vitro-differentiated Th1 cells, we identified both known and novel prenylated proteins, some of which exhibited differential prenylation during Th1 cell activation, highlighting the dynamic nature of the Th1 prenylome. Characterisation of these proteins revealed isoform-specific prenylation, novel C-terminal prenylation motifs, and a structural motif associated with internal prenylation. Furthermore, statin treatment influenced the Th1 prenylome, altering protein prenylation in a prenyltransferase-dependent manner, underscoring distinct enzymatic specificities and potential off-target effects. Our findings confirm that prenylation plays a key role in Th1 cell function, with more proteins undergoing prenylation than previously known, some of which exhibit activation-dependent changes. The identification of non-canonical prenylation events challenges current views on prenylation, expanding the repertoire of modification sites. Together, our molecular insights into protein prenylation in Th1 cells and the effects of prenyltransferase inhibition and statin treatment have important implications for therapeutic strategies targeting immune regulation.

BACKGROUND:Atopic dermatitis (AD) is a chronic type-2 inflammatory skin disease characterized by eczema and epithelial barrier dysfunction. Along with the type-2 cytokines IL-4 and IL-13, IL-22 contributes to AD pathogenesis. To date, most skin studies rely on reconstructed keratinocytes, which do not represent the real skin response. OBJECTIVE:Here, we report the distinct effects of IL-4, IL-13, and IL-22 on bio-stabilized human skin with intact barriers and immune cells. METHODS:Spatial transcriptomics on AD-lesions and non-lesional skin was performed. Ex vivo skin barrier integrity was evaluated using electrical impedance spectroscopy (EIS), RNA-sequencing, and untargeted proteomics, complemented by analyses of skin biopsies from dupilumab-treated AD patients. RESULTS:Spatial transcriptomics demonstrated that AD lesions showed reduced expression of key barrier genes, including CLDN1, FLG, and FLG2. IL-4, IL-13, and IL-22 disrupted the skin barrier in the ex vivo human skin. Combining type-2 cytokines and IL-22 alone downregulated genes critical for barrier function and keratinization. In addition, IL-4 and IL-13 downregulated antimicrobial peptides, while IL-22 upregulated them. Interestingly, IL-4 and IL-13 reduced IL-22Rα1, and IL-22 upregulated IL-4Rα, suggesting immune cross-regulation. Proteomic analysis confirmed that all three cytokines (IL-4, IL-13, and IL-22) reduced the expression of key skin barrier proteins, particularly filaggrin and claudin-1. Dupilumab treatment of AD patients for 3 months restored IL-4/IL-13-dysregulated genes, whereas it had limited effect on IL22-associated pathways. CONCLUSION:This comprehensive study provides insights into the distinct immune profiles following IL-4, IL-13, and IL-22 stimulation on human skin, highlighting their complex interplay in disrupting skin barrier function and modulating innate immune responses.

The tuft cell-group 2 innate lymphoid cell (ILC2) circuit orchestrates rapid type 2 responses upon detecting microbially derived succinate and luminal helminths. Our findings delineate key mechanistic steps involving IP3R2 engagement and Ca2+ flux, governing interleukin-25 (IL-25) production by tuft cells triggered by succinate detection. While IL-17RB has a pivotal intrinsic role in ILC2 activation, it exerts a regulatory function in tuft cells. Tuft cells exhibit constitutive Il25 expression, placing them in an anticipatory state that facilitates rapid production of IL-25 protein for ILC2 activation. Tuft cell IL-17RB is crucial for restraining IL-25 bioavailability, preventing excessive tonic ILC2 stimulation due to basal Il25 expression. Supraoptimal ILC2 stimulation by IL-25 resulting from tuft cell Il17rb deficiency or prolonged succinate exposure induces a state of hypoproliferation in ILC2s, also observed in chronic helminth infection. Our study offers critical insights into the regulatory dynamics of IL-25 in this circuit, highlighting the delicate tuning required for responses to diverse luminal states.

INTRODUCTION:Eosinophilic esophagitis (EoE) is a chronic inflammatory condition with an incompletely understood immuno-pathogenesis involving a T2 response. EoE is triggered by food allergens although, unlike IgE-mediated allergies, it exhibits high IgG4 levels in oesophageal biopsies and in circulation. We investigated whether other antibody isotypes specific for food allergens are elevated in EoE and vary with disease activity. METHODS:Plasma samples from patients with active EoE (n = 51), inactive EoE (n = 82) and non-EoE controls (n = 14) were analysed for food-specific IgG and IgA subclasses against casein, whey, wheat, egg and individual cow's milk allergens by ELISA. α-lactalbumin (Bos d 4)- and β-lactoglobulin (Bos d 5)-specific B cells were measured by flow cytometry in a subset of patients. RESULTS:Food allergen-specific antibodies in the plasma varied across EoE subgroups and non-EoE controls. Elevated IgG4 in EoE patients confirmed a strong antibody response to food allergens, including casein, wheat and egg. αS1-casein (Bos d 9)-specific IgG, IgG2, IgG4, IgA1 and IgA2 differed between EoE and non-EoE controls and between active and inactive EoE. β-casein (Bos d 11, A1 variant) measurements showed higher levels of specific IgG2 and IgG4 in both EoE groups, whereas whey-derived allergens showed opposing responses: Bos d 4 responses favoured IgG4, and Bos d 5 responses were elevated across multiple IgG and IgA subclasses in EoE. Allergen-specific B cells could not be isolated from the circulation. CONCLUSION:Our findings reveal distinct antibody profiles in EoE plasma, with elevated IgG and IgA subclasses beyond IgG4, highlighting a complex immune response to food allergens. Differential antibody responses support their clinical relevance in dietary management strategies, while the absence of allergen-specific B cells in circulation likely restricts antibody production to the inflamed oesophagus. Future research should explore whether these antibody profiles can guide personalised treatment and novel therapeutic targets in EoE.

Long Covid is a debilitating condition of unknown etiology. We performed multimodal proteomics analyses of blood serum from COVID-19 patients followed up to 12 months after confirmed severe acute respiratory syndrome coronavirus 2 infection. Analysis of >6500 proteins in 268 longitudinal samples revealed dysregulated activation of the complement system, an innate immune protection and homeostasis mechanism, in individuals experiencing Long Covid. Thus, active Long Covid was characterized by terminal complement system dysregulation and ongoing activation of the alternative and classical complement pathways, the latter associated with increased antibody titers against several herpesviruses possibly stimulating this pathway. Moreover, markers of hemolysis, tissue injury, platelet activation, and monocyte–platelet aggregates were increased in Long Covid. Machine learning confirmed complement and thromboinflammatory proteins as top biomarkers, warranting diagnostic and therapeutic interrogation of these systems.

Rhinoviruses and allergens, such as house dust mite are major agents responsible for asthma exacerbations. The influence of pre-existing airway inflammation on the infection with severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) is largely unknown. We analyse mechanisms of response to viral infection in experimental in vivo rhinovirus infection in healthy controls and patients with asthma, and in in vitro experiments with house dust mite, rhinovirus and SARS-CoV-2 in human primary airway epithelium. Here, we show that rhinovirus infection in patients with asthma leads to an excessive RIG-I inflammasome activation, which diminishes its accessibility for type I/III interferon responses, leading to their early functional impairment, delayed resolution, prolonged viral clearance and unresolved inflammation in vitro and in vivo. Pre-exposure to house dust mite augments this phenomenon by inflammasome priming and auxiliary inhibition of early type I/III interferon responses. Prior infection with rhinovirus followed by SARS-CoV-2 infection augments RIG-I inflammasome activation and epithelial inflammation. Timely inhibition of the epithelial RIG-I inflammasome may lead to more efficient viral clearance and lower the burden of rhinovirus and SARS-CoV-2 infections.

Abstract Background and Aims Exacerbated immune activation, intestinal dysbiosis and a disrupted intestinal barrier are common features among inflammatory bowel disease [IBD] patients. The polyamine spermidine, which is naturally present in all living organisms, is an integral component of the human diet, and exerts beneficial effects in human diseases. Here, we investigated whether spermidine treatment ameliorates intestinal inflammation and offers therapeutic potential for IBD treatment. Methods We assessed the effect of oral spermidine administration on colitis severity in the T cell transfer colitis model in Rag2−/− mice by endoscopy, histology and analysis of markers of molecular inflammation. The effects on the intestinal microbiome were determined by 16S rDNA sequencing of mouse faeces. The impact on intestinal barrier integrity was evaluated in co-cultures of patient-derived macrophages with intestinal epithelial cells. Results Spermidine administration protected mice from intestinal inflammation in a dose-dependent manner. While T helper cell subsets remained unaffected, spermidine promoted anti-inflammatory macrophages and prevented the microbiome shift from Firmicutes and Bacteroides to Proteobacteria, maintaining a healthy gut microbiome. Consistent with spermidine as a potent activator of the anti-inflammatory molecule protein tyrosine phosphatase non-receptor type 2 [PTPN2], its colitis-protective effect was dependent on PTPN2 in intestinal epithelial cells and in myeloid cells. The loss of PTPN2 in epithelial and myeloid cells, but not in T cells, abrogated the barrier-protective, anti-inflammatory effect of spermidine and prevented the anti-inflammatory polarization of macrophages. Conclusion Spermidine reduces intestinal inflammation by promoting anti-inflammatory macrophages, maintaining a healthy microbiome and preserving epithelial barrier integrity in a PTPN2-dependent manner.

Background: The increased prevalence of many chronic inflammatory diseases linked to gut epithelial barrier leakiness has prompted us to investigate the role of extensive use of dishwasher detergents, among other factors. Objective: We sought to investigate the effects of professional and household dishwashers, and rinse agents, on cytotoxicity, barrier function, transcriptome, and protein expression in gastrointestinal epithelial cells. Methods: Enterocytic liquid-liquid interfaces were established on permeable supports, and direct cellular cytotoxicity, transepithelial electrical resistance, paracellular flux, immunofluorescence staining, RNA-sequencing transcriptome, and targeted proteomics were performed. Results: The observed detergent toxicity was attributed to exposure to rinse aid in a dose-dependent manner up to 1:20,000 v/v dilution. A disrupted epithelial barrier, particularly by rinse aid, was observed in liquid-liquid interface cultures, organoids, and gut-on-a-chip, demonstrating decreased transepithelial electrical resistance, increased paracellular flux, and irregular and heterogeneous tight junction immunostaining. When individual components of the rinse aid were investigated separately, alcohol ethoxylates elicited a strong toxic and barrier-damaging effect. RNA-sequencing transcriptome and proteomics data revealed upregulation in cell death, signaling and communication, development, metabolism, proliferation, and immune and inflammatory responses of epithelial cells. Interestingly, detergent residue from professional dishwashers demonstrated the remnant of a significant amount of cytotoxic and epithelial barrier-damaging rinse aid remaining on washed and ready-to-use dishware. Conclusions: The expression of genes involved in cell survival, epithelial barrier, cytokine signaling, and metabolism was altered by rinse aid in concentrations used in professional dishwashers. The alcohol ethoxylates present in the rinse aid were identified as the culprit component causing the epithelial inflammation and barrier damage. (J Allergy Clin Immunol 2023;151:469-84.)

Short-chain fatty acids (SCFAs) produced by the gut microbiota have previously been demonstrated to play a role in numerous chronic inflammatory diseases and to be key mediators in the gut-bone signaling axis. However, the role of SCFAs in bone fracture healing and its impact on systemic inflammation during the regeneration process has not been extensively investigated yet. The aim of this study was to first determine the effects of the SCFA butyrate on key cells involved in fracture healing in vitro, namely, osteoclasts and mesenchymal stromal cells (MSCs), and second, to assess if butyrate supplementation or antibiotic therapy impacts bone healing, systemic immune status, and inflammation levels in a murine osteotomy model. Butyrate significantly reduced osteoclast formation and resorption activity in a dose-dependent manner and displayed a trend for increased calcium deposits in MSC cultures. Numerous genes associated with osteoclast differentiation were differentially expressed in osteoclast precursor cells upon butyrate exposure. In vivo, antibiotic-treated mice showed reduced SCFA levels in the cecum, as well as a distinct gut microbiome composition. Furthermore, circulating proinflammatory TNFα, IL-17a, and IL-17f levels, and bone preserving osteoprotegerin (OPG), were increased in antibiotic-treated mice compared to controls. Antibiotic-treated mice also displayed a trend towards delayed bone healing as revealed by reduced mineral apposition at the defect site and higher circulating levels of the bone turnover marker PINP. Butyrate supplementation resulted in a lower abundance of monocyte/macrophages in the bone marrow, as well as reduced circulating proinflammatory IL-6 levels compared to antibiotic- and control-treated mice. In conclusion, this study supports our hypothesis that SCFAs, in particular butyrate, are important contributors to successful bone healing by modulating key cells involved in fracture healing as well as systemic inflammation and immune responses.

BACKGROUND:In order to improve targeted therapeutic approaches for children with atopic dermatitis (AD), novel insights into the molecular mechanisms and environmental exposures that differentially contribute to disease phenotypes are required. We wished to identify AD immunological endotypes in South African children from rural and urban environments.METHODS:We measured immunological, socio-economic and environmental factors in healthy children (n = 74) and children with AD (n = 78), in rural and urban settings from the same ethno-linguistic AmaXhosa background in South Africa.RESULTS:Circulating eosinophils, monocytes, TARC, MCP-4, IL-16 and allergen-specific IgE levels were elevated, while IL-17A and IL-23 levels were reduced, in children with AD regardless of their location. Independent of AD, children living in a rural environment had the highest levels of TNFα, TNFβ, IL-1α, IL-6, IL-8, IL-21, MCP-1, MIP-1α, MIP-1β, MDC, sICAM1, sVCAM1, VEGFA, VEGFD and Tie2, suggesting a generalized microinflammation or a pattern of trained immunity without any specific TH polarization. In contrast, IL-15, IL-22, Flt1, PIGF and βFGF were highest in urban children. Rural healthy children had the lowest levels of food allergen-specific IgG4. Early life nutritional factors, medications, animal exposures, indoor environment, sunlight exposure, household size, household income and parental education levels were associated with differences in circulating cytokine levels.CONCLUSIONS:This study highlights the immunological impact of environmental exposures and socio-economic status in the manifestation of immune endotypes in children with AD living in urban and rural areas, which are important in selecting appropriately matched immunological therapies for treatment of AD.

Asthma is a heterologous disease that is influenced by complex interactions between multiple environmental exposures, metabolism, and host immunoregulatory processes. Specific metabolites are increasingly recognized to influence respiratory inflammation. However, the role of protein-derived metabolites in regulating inflammatory responses in the lung are poorly described. The aims of the present study were to quantify polyamine levels in bronchoalveolar lavages (BALs) from healthy volunteers and asthma patients, and to evaluate the impact of each polyamine on inflammatory responses using in vitro models and in a house dust mite (HDM)-induced respiratory allergy model. Spermidine levels were decreased, while cadaverine levels were increased in BALs from asthma patients compared to healthy controls, using Ultra Performance Liquid Chromatography (UPLC). Both spermine and spermidine inhibit lipopolysaccharide (LPS)-induced cytokine secretion from human peripheral blood mononuclear cells (PBMCs) and dendritic cells (DCs) in vitro. In addition, oral gavage with spermine or spermidine modulate HDM-induced cell infiltration, cytokine secretion, and epithelial cell tight junction expression in murine models. Spermidine also reduces airway hyper-responsiveness. These results suggest that modulation of polyamine metabolism, in particular spermidine, is associated with respiratory inflammation and these molecules and pathways should be further explored as biomarkers of disease and potential targets for novel therapies.

BACKGROUND:Histamine is an important immunomodulator influencing both the innate and adaptive immune system. Certain host cells express the histidine decarboxylase enzyme (HDC), which is responsible for catalysing the decarboxylation of histidine to histamine. We and others have shown that bacterial strains can also express HDC and secrete histamine; however, the influence of bacterial-derived histamine on the host immune responses distant to the gut is unclear.METHODS:The Escherichia coli BL21 (E coli BL21) strain was genetically modified to express the Morganella morganii (M morganii)-derived HDC gene (E coli BL21_HTW). E coli BL21 and E coli BL21_HTW were gavaged to ovalbumin (OVA) sensitized and challenged mice to investigate the effect of bacterial-derived histamine on lung inflammatory responses.RESULTS:Oral administration of E coli BL21_HTW, which is able to secrete histamine, to wild-type mice reduced lung eosinophilia and suppressed ex vivo OVA-stimulated cytokine secretion from lung cells in the OVA respiratory inflammation mouse model. In histamine receptor 2 (H2R)-deficient mice, administration of histamine-secreting bacteria also reduced inflammatory cell numbers in bronchoalveolar lavage (BAL). However, the suppressive effect of bacterial-derived histamine on BAL inflammation was lost in HDC-deficient mice. This loss of activity was associated with increased expression of histamine degrading enzymes and reduced histamine receptor expression.CONCLUSION:Histamine secretion from bacteria within the gut can have immunological consequences at distant mucosal sites, such as within the lung. These effects are influenced by host histamine receptor expression and the expression of histamine degrading enzymes.

BACKGROUND:Dietary changes are suggested to play a role in the increasing prevalence of allergic diseases and asthma. Short-chain fatty acids (SCFAs) are metabolites present in certain foods and are produced by microbes in the gut following fermentation of fibers. SCFAs have been shown to have anti-inflammatory properties in animal models. Our objective was to investigate the potential role of SCFAs in the prevention of allergy and asthma.METHODS:We analyzed SCFA levels by high-performance liquid chromatography (HPLC) in fecal samples from 301 one-year-old children from a birth cohort and examined their association with early life exposures, especially diet, and allergy and asthma later in life. Data on exposures and allergic diseases were collected by questionnaires. In addition, we treated mice with SCFAs to examine their effect on allergic airway inflammation.RESULTS:Significant associations between the levels of SCFAs and the infant's diet were identified. Children with the highest levels of butyrate and propionate (≥95th percentile) in feces at the age of one year had significantly less atopic sensitization and were less likely to have asthma between 3 and 6 years. Children with the highest levels of butyrate were also less likely to have a reported diagnosis of food allergy or allergic rhinitis. Oral administration of SCFAs to mice significantly reduced the severity of allergic airway inflammation.CONCLUSION:Our results suggest that strategies to increase SCFA levels could be a new dietary preventive option for allergic diseases in children.

Background: Defects in the epithelial barrier have recently been associated with asthma and other allergies. The influence of laundry detergents on human bronchial epithelial cells (HBECs) and their barrier function remain unknown. Objective: We investigated the effects of laundry detergents on cytotoxicity, barrier function, the transcriptome, and the epigenome in HBECs. Methods: Air-liquid interface cultures of primary HBECs from healthy control subjects, patients with asthma, and patients with chronic obstructive pulmonary disease were exposed to laundry detergents and detergent residue after rinsing. Cytotoxicity and epithelial barrier function were evaluated. RNA sequencing, Assay for Transposase Accessible Chromatin with high-throughput sequencing, and DNA methylation arrays were used for checking the transcriptome and epigenome. Results: Laundry detergents and rinse residue showed dosedependent toxic effects on HBECs, with irregular cell shape and leakage of lactate dehydrogenase after 24 hours of exposure. A disrupted epithelial barrier function was found with decreased transepithelial electrical resistance, increased paracellular flux, and stratified tight junction (TJ) immunostaining in HBECs exposed to laundry detergent at 1:25,000 dilutions or rinse residue at further 1:10 dilutions. RNA sequencing analysis showed that lipid metabolism, apoptosis progress, and epithelially derived alarmin-related gene expression were upregulated, whereas cell adhesionrelated gene expression was downregulated by laundry detergent at 1:50,000 dilutions after 24 hours of exposure without substantially affecting chromatin accessibility and DNA methylation. Conclusion: Our data demonstrate that laundry detergents, even at a very high dilution, and rinse residue show significant cell-toxic and directly disruptive effects on the TJ barrier integrity of HBECs without affecting the epigenome and TJ gene expression.

Background: Biogenic amines (BAs) are metabolites produced by the decarboxylation of amino acids with significant physiological functions in eukaryotic and prokaryotic cells. BAs can be produced by bacteria in fermented foods, but little is known concerning the potential for microbes within the human gut microbiota to produce or degrade BAs. Objective: To isolate and identify BA-producing and BA-degrading microbes from the human gastrointestinal tract. Design: Fecal samples from human volunteers were screened on multiple growth media, under multiple growth conditions. Bacterial species were identified using 16S rRNA sequencing and BA production or degradation was assessed using ultra-performance liquid chromatography. Results: In total, 74 BA-producing or BA-degrading strains were isolated from the human gut. These isolates belong to the genera Bifidobacterium, Clostridium, Enterococcus, Lactobacillus, Pediococcus, Streptococcus, Enterobacter, Escherichia, Klebsiella, Morganella and Proteus. While differences in production or degradation of specific BAs were observed at the strain level, our results suggest that these metabolic activities are widely spread across different taxa present within the human gut microbiota. Conclusions: The isolation and identification of microbes from the human gut with BA-producing and BA-degrading metabolic activity is an important first step in developing a better understanding of how these metabolites influence health and disease.

Microbiome-host interactions are believed to significantly influence host immunologic homeostatic mechanisms, whereas microbial dysbiosis has been associated with many inflammatory diseases, including asthma.1Huang Y.J. Boushey H.A. The microbiome in asthma.J Allergy Clin Immunol. 2015; 135: 25-30Abstract Full Text Full Text PDF PubMed Scopus (174) Google Scholar In addition to alterations in microbiome composition, the metabolic activity of the microbiome is relevant.2Arrieta M.C. Stiemsma L.T. Dimitriu P.A. Thorson L. Russell S. Yurist-Doutsch S. et al.Early infancy microbial and metabolic alterations affect risk of childhood asthma.Sci Transl Med. 2015; 7: 307ra152Crossref PubMed Scopus (958) Google Scholar One such metabolite is histamine, which is a biogenic amine with multiple effects on immunoregulatory and effector responses.3O'Mahony L. Akdis M. Akdis C.A. Regulation of the immune response and inflammation by histamine and histamine receptors.J Allergy Clin Immunol. 2011; 128: 1153-1162Abstract Full Text Full Text PDF PubMed Scopus (211) Google Scholar Secretion of histamine by microbes significantly influences immune responses within the gut, which is mediated in part by histamine type 2 receptor.4Ferstl R. Frei R. Schiavi E. Konieczna P. Barcik W. Ziegler M. et al.Histamine receptor 2 is a key influence in immune responses to intestinal histamine-secreting microbes.J Allergy Clin Immunol. 2014; 134: 744-746Abstract Full Text Full Text PDF PubMed Scopus (53) Google Scholar, 5Gao C. Major A. Rendon D. Lugo M. Jackson V. Shi Z. et al.Histamine H2 receptor-mediated suppression of intestinal inflammation by probiotic Lactobacillus reuteri.MBio. 2015; 6: e01358-e01415Google Scholar, 6Smolinska S. Jutel M. Crameri R. O'Mahony L. Histamine and gut mucosal immune regulation.Allergy. 2014; 69: 273-281Crossref PubMed Scopus (114) Google Scholar Evaluation of histamine secretion by the human gut microbiome has not been previously assessed in healthy human volunteers or patients with asthma. In the present study, we quantified the burden of histamine-secreting bacteria in the human gut microbiome and identified specific bacterial strains that secrete high levels of histamine ex vivo. Fecal samples were obtained from healthy volunteers (n = 74; mean age, 41.7 years; male:female, 29:45) and adult patients with asthma (n = 74; mean age, 41.9 years; male:female, 29:45). The study-specific procedures were approved by the Wroclaw Medical University Ethics Committee. The bacterial histidine decarboxylase (HDC) gene was quantified in isolated DNA using primers validated for bacterial HDC, but that do not amplify the human HDC gene (for a representative gel, see Fig E1 in this article's Online Repository at www.jacionline.org). Twelve different primer pairs (see Table E1 in this article's Online Repository at www.jacionline.org) were used for quantification of the bacterial HDC gene because no one primer set can amplify all bacterial HDC gene sequences that have been previously described. Bacterial HDC gene levels were significantly elevated in adult patients with asthma compared with healthy controls (Fig 1, A). Within the asthma group, there were clearly patients with high or low HDC levels. To determine the patient characteristics that might better identify patients with high or low bacterial HDC levels, we separated patients on the basis of demographic and available clinical data. Interestingly, the patient characteristic that gave the best separation was body mass index (BMI). Nonobese patients with asthma (n = 39; BMI, 20-25) had the highest level of the bacterial HDC gene (Fig 1, B) compared with obese patients with asthma (n = 35; BMI, >30). There was no difference in bacterial HDC levels between nonobese (n = 37) and obese (n = 37) controls without asthma (Fig 1, B). As a possible explanation for the difference in bacterial HDC levels between obese and nonobese patients with asthma, we assessed dietary habits using a food frequency questionnaire, but no significant differences were observed between the different groups (see Table E2 in this article's Online Repository at www.jacionline.org). However, more detailed dietary analysis is required before definitive conclusions can be made on the influence of diet on histamine-secreting microbes within the gut. We further selected those patients with asthma with the highest HDC level using the 90% percentile (>387 HDC gene copy number/ng DNA, termed HDChigh) and compared them with all remaining patients with asthma (<387 HDC gene copy number/ng DNA, termed HDClow). HDChigh patients had significantly lower forced expiratory volume (FEV1) values compared with HDClow patients (see Table E3 in this article's Online Repository at www.jacionline.org). All HDChigh patients (100%) were atopic (to house dust mite and/or grass pollen allergens), but most HDClow patients (76%) were also atopic, suggesting that atopy is not caused by a high burden of histamine-secreting bacteria, but the presence of a large number of these bacteria may support an allergic phenotype (see Table E3). Other bacterial metabolites generated in the gut (eg, short-chain fatty acids) have clearly been shown to influence susceptibility and severity of allergic disorders.7Marsland B.J. Trompette A. Gollwitzer E.S. The gut-lung axis in respiratory disease.Ann Am Thorac Soc. 2015; 12: S150-S156PubMed Google Scholar, 8Frei R. Lauener R.P. Crameri R. O'Mahony L. Microbiota and dietary interactions: an update to the hygiene hypothesis?.Allergy. 2012; 67: 451-461Crossref PubMed Scopus (102) Google Scholar Similarly to histamine, short-chain fatty acids exert many of their effects by binding to G protein–coupled receptors and perhaps there are additional immunoregulatory G protein–coupled receptors, yet undiscovered, that respond to bacterial-derived metabolites. None of the other parameters assessed (age, sex, smoking or alcohol history, drug usage, or severity indices) were significantly different between HDChigh and HDClow patients with asthma (see Table E3). To identify some of the bacterial strains, within the gut microbiome of HDChigh patients with asthma, that secrete histamine, we cultured their fecal samples on multiple growth media, under multiple different growth conditions, in the presence of histidine and a pH color change indicator (protocol details are included in this article's Online Repository at www.jacionline.org). Presumptive histamine-secreting strains were further screened using quantitative PCR and ultra-performance liquid chromatography to confirm the presence of the HDC gene and the secretion of histamine, respectively (for a representative ultra-performance liquid chromatography chromatogram, see Fig E2, A, in this article's Online Repository at www.jacionline.org). Finally, bacterial culture supernatants were used to stimulate CHO cells, which possess a histamine receptor 1 (HR1) chemiluminescent reporter. Histamine in the bacterial culture supernatants activated the HR1 on these cells and activity was blocked using the HR1 antagonist diphenhydramine (see Fig E2, B). A number of bacterial isolates that secrete histamine have been identified from HDChigh patients with asthma, and 16S sequencing of these strains revealed that most are Escherichia coli, with Lactobacillus vaginalis and Morganella morganii strains also being identified as histamine-secreting organisms (Table I). Interestingly, both E coli and M morganii are frequently implicated as causative agents in scombroid food poisoning (a histamine-mediated pathology).6Smolinska S. Jutel M. Crameri R. O'Mahony L. Histamine and gut mucosal immune regulation.Allergy. 2014; 69: 273-281Crossref PubMed Scopus (114) Google Scholar, 9Feng C. Teuber S. Gershwin M.E. Histamine (Scombroid) fish poisoning: a comprehensive review.Clin Rev Allergy Immunol. 2016; 50: 64-69Crossref PubMed Scopus (116) Google Scholar Using 16S primers specific to either E coli or M morganii, we quantified the presence of these microbes in the fecal samples of healthy volunteers and patients with asthma from our cohort. E coli levels were not significantly different between the groups (see Fig E3 in this article's Online Repository at www.jacionline.org), but M morganii levels were significantly elevated in the gut microbiome of nonobese patients with asthma, compared with obese patients with asthma, obese patients without asthma, or nonobese controls without asthma (Fig 1, C). Within the nonobese asthma group, patients with more severe disease had the highest levels of M morganii (Fig 1, D). Disease severity (mild, moderate, or severe asthma) was defined by medication use, medication dose, and a symptom control evaluation. Although culture-dependent approaches are very biased because most intestinal microbes cannot be cultured yet in vitro, these results suggest that histamine-producing microbes, particularly M morganii, should be examined in more detail in the context of asthmatic diseases.Table IHistamine secretion by isolated bacterial strainsStrainHistamine (mg/L)∗Histamine was detected via ultra-performance liquid chromatography after 24-, 48-, and 96-hours incubation in Brain Heart Infusion agar supplemented with 1% histidine and 0.005% pyridoxal-HCl (pH 6.5) at 37°C.16S rRNAGenBank accession no.24 h48 h96 hEscherichia coli 1DT242381521KU612261 2DT12.843.3179KU612262 3DT261363722KU612263 4DT0197591KU612264 5DT17.414.3182KU612265Morganella morganii 6DT684567767722KU612266Lactobacillus vaginalis 7DT887070297961KU612267Enterobacter aerogenes ATCC 13048†Positive control strain for histamine secretion.754876766019—Lactobacillus casei ATCC 334‡Negative control strains for histamine secretion.000—Enterococcus durans ATCC 6056‡Negative control strains for histamine secretion.000—ATCC, American Type Culture Collection.∗ Histamine was detected via ultra-performance liquid chromatography after 24-, 48-, and 96-hours incubation in Brain Heart Infusion agar supplemented with 1% histidine and 0.005% pyridoxal-HCl (pH 6.5) at 37°C.† Positive control strain for histamine secretion.‡ Negative control strains for histamine secretion. Open table in a new tab ATCC, American Type Culture Collection. No longer can we assume that mast cells and basophils are the principal cellular sources of histamine in the human body because clearly many resident bacterial strains produce histamine and their levels are increased in the gut of adult nonobese patients with asthma. On the basis of these observations, we speculate that increased levels of bacterial-derived histamine in certain adult patients with asthma may contribute to histamine-mediated pathologies due to a higher systemic level of histamine, which then reduces the level required for host-derived histamine to drive allergic responses following allergen exposure. The difference in HDC-positive bacteria between obese and nonobese patients with asthma suggests that factors other than histamine secretion by microbes in the gut may be more important for the development of asthma in obese patients. Indeed, this report adds to the growing body of evidence that asthma in obese individuals represents a distinct endotype. More accurate endotyping of patients with asthma may be assisted by further analysis of the composition and metabolic activity of an individual's microbiome, and future clinical studies of new therapeutic agents should consider performing microbiome and metabolite analyses to determine whether specific microbiome features correlate with responses to treatment. In addition, therapeutics directly targeting microbiome activities may be considered as complementary to existing drugs. Fecal samples were obtained from all individuals early in the day and were transported at 4°C to the clinic. All samples were frozen at −80°C within 4 hours of collection. DNA was isolated from the fecal samples with QIAamp DNA Stool Mini Kit (QIAGEN GmbH, Hilden, Germany) and all the samples were adjusted to the same concentration. Following DNA isolation, bacterial HDC was quantified using quantitative PCR (qPCR). Because of the high level of polymorphisms of the bacterial HDC gene, 12 different primer sets were used to investigate the presence of HDC genes (see Table E1). qPCR analysis was performed by using an Applied Biosystems 7900 HT Fast Real-Time PCR system. The cycling conditions were as follows: 40 cycles of 50°C for 2 minutes, 95°C for 10 minutes, 95°C for 15 seconds, 60°C for 1 minute. Bacteria were isolated from fecal samples from patients with asthma. Two milliliter of PBS (Life Technologies Corporation, Grand Island, NY) was added to each fecal sample, and the obtained suspension was vortexed until homogeneity. The solution was centrifuged at 4°C, 1000 rpm, for 3 minutes to pelet the fecal material. Hundred microliter of supernatant was platted on Brain Heart Infusion agar (BHI; Oxoid Ltd, Basingstoke, Hampshire, England), Tryptic Soy Agar (Oxoid Ltd), de Man, Rogosa, and Sharpe agar (Becton, Dickinson and Company, Sparks, Md), and Reinforced Clostriudial Medium agar (Oxoid Ltd) supplemented with 2.7% histidine, and 0.006% bromocresol purple (Acros Organics, Morris Plains, NJ). Bromocresol purple was added to the medium as a pH indicator, because when bacteria produce histamine, the pH increases and the colony can be identified because of its purple color. Pure isolates were obtained by transferring single colonies 3 times onto the corresponding medium, and were then cryopreserved in 40% glycerol (Sigma-Aldrich, St Louis, Mo). Because bacterial histamine production depends on the growth conditions, each purified isolate was then screened under 12 different conditions in a 96-well format: 4 media (BHI, Reinforced Clostriudial Medium agar, de Man, Rogosa, and Sharpe agar, and Tryptone Soya Broth) and 3 different pHs (6.5, 6.0, and 5.5) were used. Media were supplemented with 0.005% of pyridoxal-5-phosphate, 0.006% bromocresol purple, and 1% histidine. Plates were incubated at 37°C under anerobic conditions. Histamine production was determined visually after 24 and 48 hours, and was considered as positive when medium color turned purple under at least 1 condition after 48 hours. A total of 161 presumptive isolates were obtained from 14 fecal samples from patients with asthma and were screened for the presence of the HDC gene using qPCR under the same conditions and with the same primers as described above. Genomic DNA was purified from the isolates using GenElute Bacterial Genomic DNA Kit (Sigma-Aldrich). The 16S rRNA genes were amplified via PCR using primers 27F and 1492R and GoTaq Green master mix polymerase (Promega Corporation, Madison, Wis) under the following conditions: (1) 95°C for 1 minute; (2) 95°C for 40 seconds, 54°C for 45 seconds, and 72°C for 1 minute (32 cycles); and (3) 72°C for 10 minutes. The 16S rRNA genes were sequenced by Microsynth AG (Balgach, Switzerland) and subsequently compared with all GenBank entries by BLASTN search. Sequences were uploaded to GenBank and assigned a GenBank accession number (Table I). Standard chemicals for histamine dihydrochloride, putrescine dihydrochloride, and cadaverine dihydrochloride (Acros Organics) were of analytical grade. Standard stock solutions were separately prepared at 2000 mg/L in distilled water, and were further diluted for experiments. Isolated bacteria were grown in BHI medium supplemented with pyridoxal-5-phosphate at 37°C and under anerobic conditions as described above. Bacterial supernatants were obtained after 24, 48, and 96 hours by centrifugation at 9000g for 10 minutes. Samples were stored at –20°C until derivatization. One milliliter of bacterial supernatant or standard solution was mixed with 200 μL of 2 mol NaOH, 300 μL of saturated sodium bicarbonate solution, and 2 mL of dansyl chloride (Sigma-Aldrich) solution (10 mg/mL in acetone), and was then incubated at 40°C for 45 minutes. Residual dansyl chloride was removed by adding 100 μL of 25% ammonium hydroxide (Merck, Darmstadt, Germany). After 30 minutes at 25°C, the volume was adjusted to 5 mL with acetonitrile (Biosolve Chimie, Dieuze, France), centrifuged at 3000g for 5 minutes, and supernatants were filtered (0.22 μm) before ultra-performance liquid chromatography (UPLC) analysis. The separation was carried out on an ACQUITY UPLC H-Class Bio System (Waters Corp, Milford, Mass) equipped with a quaternary solvent manager, sample manager FTN, column manager, and diode array detector. Data processing was performed using MassLynxV4.1 (Waters Corp). An ACQUITY UPLC BEHC18 column (1.7 μm particle size, 2.1 mm × 50 mm, Waters Corp) was used for the separation of biogenic amines, and the samples were eluted with a gradient elution of (A) acetonitrile (100%), (B) acetonitrile (50%) as follows: 0-2 minutes, A 30%, B 70%; 2-4 minutes, A 30% to 45%, B 70% to 55%; 4-5.7 minutes, A 45% to 90%, B 55% to 10%; 5.7-7.7 minutes, A 90% to 95%, B 10% to 5%; 7.7-8.7 minutes, A 95% to 30%, B 5% to 70%; 8.7-13.7 minutes, A 30%, B 70%. The flow rate was kept at 0.22 mL/min, column temperature at 25°C, injection at 1 μL, and the detection wavelength was 217 nm. The PathHunter CHO-K1 histamine receptor 1 (H1R) β-arrestin cell line (DiscoverX, Fremont, Calif) was used to assess whether histamine secreted by bacteria would activate H1R in vitro. Activation of the histamine receptor in this cell line induces β-Arrestin-EA recruitment, forcing complementation of 2 enzyme fragments. The resulting functional enzyme hydrolyzes a substrate to generate a chemiluminescent signal. Dilutions of filtered bacterial culture supernatants were added to the cells in the presence or absence of the H1R antagonist diphenhydramine (Sigma-Aldrich). Histamine (Sigma-Aldrich) was used as a positive control. Cell cultures and reporter measurements were performed according to the manufacturer's instructions (DiscoverX). Statistical significance between groups was calculated using the parametric t test or the nonparametric t test Mann-Whitney as appropriate. Differences in proportions were calculated using chi-square tests. All data analysis was carried out using GraphPrism software (GraphPad Sofware, Inc, San Diego, Calif).Fig E2Histamine in bacterial culture supernatants. A, A representative UPLC chromatogram illustrating the detection of bacterial-derived histamine in culture supernatants. B, Bacterial culture supernatants, containing histamine, activate histamine receptor 1, on a reporter cell line, which is blocked by the histamine receptor 1 antagonist diphenhydramine.View Large Image Figure ViewerDownload Hi-res image Download (PPT)Fig E3Escherichia coli levels in fecal samples. E coli are present at similar levels within the gut microbiome of patients with asthma and volunteers without asthma.View Large Image Figure ViewerDownload Hi-res image Download (PPT)Table E1Primer sequences used for quantitative real-time PCR analysisPrimer setSense primerAntisense primerCL1_ CL2CCWGGWAAWATWGGWAATGGWTAGAWGCWGTWGTCATATTWATTTGWCCJV16HC_ JV17HCAGATGGTATTGTTTCTTATGAGACCATACACCATAACCTTJV17_ CL1modAGACCATACACCATAACCTTGCCAGGWAACATTGGTAATGGATAHDC3_ HDC4GATGGTATTGTTTCKTATGACAAACACCAGCATCTTCHIS1-F_ HIS1-RGGNATNGTNWSNTAYGAYMGNGCNGAATNGCDATNGCNSWCCANACNCCRTAHdc1_ Hdc2TTGACCGTATCTCAGTGAGTCCATACGGTCATACGAAACAATACCATCHDC1_ HDC2ATGTCAGAGTTTGATAAAAAGTTAATAATTGATGTTTCCACCHDC-for_ HDC-revTGGTATTGTTTCGTATGACCGGGCTTCATCATTGCATGTGCKPF2_ KPR4AAAGCTGGGGGTATGTGACCGTGATGGAGTTTTTGTTGC106_107AAYTCNTTYGAYTTYGARAARGARGATNGGNGANCCDATCATYTTRTGNCCH1S2-F_ H1S2-RAAYTSNTTYGAYTTYGARAARGARGTTANGGNSANCCDATCATYTTRTGNCChdc-f_ hdc-rTCHATYARYAACTGYGGTGACTGGRGCCCACAKCATBARWGGDGTRTGRCCMm453F- Mm631R (M morganii)TTTCAGTCGGGAGGAAGGTGGGGGATTTCACATCTGACTCEC23S857 F – R (Escherichia coli)GGTAGAGCACTGTTTTGGCATGTCTCCCGTGATAACTTTCTC Open table in a new tab Table E2Consumption frequency of major food groups (number of times per week)Food groupNonobese nonasthmaObese nonasthmaNonobese asthmaObese asthmaP valueVegetables4.9 ± 1.94.8 ± 1.75.9 ± 3.35.4 ± 2.3.148Meat & meat products4.1 ± 2.04.8 ± 3.05.0 ± 2.25.0 ± 3.9.501Fish & fish products1.7 ± 1.41.9 ± 1.51.6 ± 1.21.7 ± 1.4.722Fruits & fruit products5.4 ± 2.25.4 ± 1.95.5 ± 3.25.3 ± 2.7.996Salads4.3 ± 1.64.0 ± 2.04.2 ± 2.14.1 ± 2.6.909Values are mean ± SD. Open table in a new tab Table E3Demographic and clinical characteristics of HDChigh and HDClow patients with asthma and controls without asthmaCharacteristicHDChighHDClowControlsP valuen96574BMI26.7 ± 6.628.9 ± 7.329.1 ± 7.8.686Age (y)39.3 ± 11.542.2 ± 12.141.7 ± 13.3.809Male/female3/626/3929/45.929Smoker1 (11)12 (18)28 (38).023Alcohol (U/wk)2.0 ± 2.42.0 ± 3.42.1 ± 2.4.969FEV1 %65.8 ± 14.475.9 ± 9.5NA.032Atopic9 (100)50 (76)3 (4)∗Food allergy or atopic dermatitis..001Antibiotics1 (11)4 (6)1 (1).194Daily ICS6 (66)57 (87)NA.097Daily ICS dose†Dose of inhaled glucocorticosteroids calculated as a budesonide equivalent μg/d.768 ± 674810 ± 681NA.951Systemic steroids2 (22)6 (9)NA.239SABA6 (66)35 (54)NA.468LABA5 (56)43 (66)NA.390Daily LABA dose‡Dose of LABA calculated as a salmeterol equivalent μg/d.67 ± 7073 ± 71NA.794Antihistamines§Antihistamine receptor 1 antagonists.6 (66)39 (60)NA.701Leukotriene receptor antagonist6 (66)36 (55)NA.522Daytime asthma symptoms >2 times?2 (22)20 (31)NA.559Exercise/activity limited because of asthma?5 (55)29 (44)NA.537Waking at night due to asthma symptoms?4 (44)21 (32)NA.471Use of rescue medications >2 times?3 (33)19 (29)NA.801Values are mean ± SD or n (%). Statistically significant differences are highlighted in boldface (P < .05).ICS, Inhaled corticosteroid; LABA, long-acting beta agonist; NA, not available/applicable; SABA, short-acting beta agonist.∗ Food allergy or atopic dermatitis.† Dose of inhaled glucocorticosteroids calculated as a budesonide equivalent μg/d.‡ Dose of LABA calculated as a salmeterol equivalent μg/d.§ Antihistamine receptor 1 antagonists. Open table in a new tab Values are mean ± SD. Values are mean ± SD or n (%). Statistically significant differences are highlighted in boldface (P < .05). ICS, Inhaled corticosteroid; LABA, long-acting beta agonist; NA, not available/applicable; SABA, short-acting beta agonist.