LY3295668 chemical characterization

Supplementary Figure 1 from SGX523 is an exquisitely selective, ATP-competitive inhibitor of the MET receptor tyrosine kinase with antitumor activity in vivo

Abs IC50 values (µM) for 36 small molecule inhibitors across a panel of cancer cell lines.

Supplementary Tables 1-3, Figures 1-4 from SGX523 is an exquisitely selective, ATP-competitive inhibitor of the MET receptor tyrosine kinase with antitumor activity in vivo

Abs IC50 values (µM) for LY3295668 across a panel of 580 cell lines.

shRNA suppressor screening data for H446 and MDA-MB-468 cells (tabs 1, 2) and RNA expression level associations with LY3295668 Abs IC50 values from 493 cancer cell lines (tab 3).

To date, IL-17A antibodies remain the only therapeutic approach to correct the abnormal activation of the IL-17A/IL-17R signaling complex. Why is it that despite the remarkable success of IL-17 antibodies, there is no small molecule antagonist of IL-17A in the clinic? Here we offer a unique approach to address this question. In order to understand the interaction of IL-17A with its receptor, we combined peptide discovery using phage display with HDX, crystallography, and functional assays to map and characterize hot regions that contribute to most of the energetics of the IL-17A/IL-17R interaction. These functional maps are proposed to serve as a guide to aid in the development of small molecules that bind to IL-17A and block its interaction with IL-17RA.

Abstract Loss-of-function mutations in the retinoblastoma gene RB1 are common in several treatment-refractory cancers such as small-cell lung cancer and triple-negative breast cancer. To identify drugs synthetic lethal with RB1 mutation (RB1mut), we tested 36 cell-cycle inhibitors using a cancer cell panel profiling approach optimized to discern cytotoxic from cytostatic effects. Inhibitors of the Aurora kinases AURKA and AURKB showed the strongest RB1 association in this assay. LY3295668, an AURKA inhibitor with over 1,000-fold selectivity versus AURKB, is distinguished by minimal toxicity to bone marrow cells at concentrations active against RB1mut cancer cells and leads to durable regression of RB1mut tumor xenografts at exposures that are well tolerated in rodents. Genetic suppression screens identified enforcers of the spindle-assembly checkpoint (SAC) as essential for LY3295668 cytotoxicity in RB1-deficient cancers and suggest a model in which a primed SAC creates a unique dependency on AURKA for mitotic exit and survival. Significance: The identification of a synthetic lethal interaction between RB1 and AURKA inhibition, and the discovery of a drug that can be dosed continuously to achieve uninterrupted inhibition of AURKA kinase activity without myelosuppression, suggest a new approach for the treatment of RB1-deficient malignancies, including patients progressing on CDK4/6 inhibitors. See related commentary by Dick and Li, p. 169. This article is highlighted in the In This Issue feature, p. 151

As part of our ongoing efforts to identify novel ligands for the metabotropic glutamate 2 and 3 (mGlu2/3) receptors, we have incorporated substitution at the C3 and C4 positions of the (1S,2R,5R,6R)-2-amino-bicyclo[3.1.0]hexane-2,6-dicarboxylic acid scaffold to generate mGlu2/3 antagonists. Exploration of this structure-activity relationship (SAR) led to the identification of (1S,2R,3S,4S,5R,6R)-2-amino-3-[(3,4-difluorophenyl)sulfanylmethyl]-4-hydroxy-bicyclo[3.1.0]hexane-2,6-dicarboxylic acid hydrochloride (LY3020371·HCl, 19f), a potent, selective, and maximally efficacious mGlu2/3 antagonist. Further characterization of compound 19f binding to the human metabotropic 2 glutamate (hmGlu2) site was established by cocrystallization of this molecule with the amino terminal domain (ATD) of the hmGlu2 receptor protein. The resulting cocrystal structure revealed the specific ligand-protein interactions, which likely explain the high affinity of 19f for this site and support its functional mGlu2 antagonist pharmacology. Further characterization of 19f in vivo demonstrated an antidepressant-like signature in the mouse forced-swim test (mFST) assay when brain levels of this compound exceeded the cellular mGlu2 IC50 value.

On May 11 and 12, 2000, the Stanford Synchrotron Radiation Laboratory, as it was then known, hosted a "Workshop on Techniques for Automated Mounting, Viewing and Centering Pre-Cooled Protein Crystals" [1 http://www-ssrl.slac.stanford.edu/conferences/workshops/px-robotics/. [Google Scholar], 2 E. Abola, Nature Structural Biology 7, 973–977 (2000).[Crossref], [PubMed] , [Google Scholar]]. The 12 presentations during the meeting all focused on the impact that automation could have on the performance of synchrotron beamlines and thus on research in structural biology. Two principal themes ran through the workshop: (1) robotics to mount crystals on a diffractometer; and (2) methods to place a crystal in the X-ray beam. Five conceptual and prototype robotic systems for automated mounting were described—the original ACTOR from Abbott Laboratories, later modified and marketed by Rigaku/MSC, and the systems which in final form become the ALS [3 G. Snell, Structure 12, 537–545 (2004).[Crossref], [PubMed], [Web of Science ®] , [Google Scholar]], EMBL/ESRF SC3 [4 F. Cipriani, Acta Cryst. D62(10), 1251–1259 (2006). [Google Scholar]], APS/SBC [5 D. Shu, AIP Conference Proceedings 705(1), 1201–1204 (2004).[Crossref] , [Google Scholar]], and SSRL SAM robots [6 A. E. Cohen, J. Appl. Cryst. 5(6), 720–726 (2002).[Crossref], [Web of Science ®] , [Google Scholar]]. By December of that year, the ACTOR had been installed for testing at Sector 32 of the Advanced Photon Source (Figure 1). Within three years, by the end of 2003, several of these robots, plus the commercial MARcsc from MAR Research, had been deployed to handle frozen protein crystals at beamlines for macromolecular crystallography (MX). Currently, at least 13 distinct robot types, not including variants of the ALS automounter, are employed at synchrotron beamlines to transfer crystals from storage to beam position.

Synchrotron X-ray sources provide the highest quality crystallographic data for structure-guided drug design. In general, industrial utilization of such sources has been intermittent and occasionally limited. The Lilly Research Laboratories Collaborative Access Team (LRL-CAT) beamline provides a unique alternative to traditional synchrotron use by pharmaceutical and biotechnology companies. Crystallographic experiments at LRL-CAT and the results therefrom are integrated directly into the drug discovery process, permitting structural data, including screening of fragment libraries, to be routinely and rapidly used on a daily basis as part of pharmaceutical lead discovery and optimization. Here we describe how LRL-CAT acquires and disseminates the results from protein crystallography to maximize their impact on the development of new potential medicines.

The nuclear pore complex (NPC), embedded in the nuclear envelope, is a large, dynamic molecular assembly that facilitates exchange of macromolecules between the nucleus and the cytoplasm. The yeast NPC is an eightfold symmetric annular structure composed of similar to 456 polypeptide chains contributed by similar to 30 distinct proteins termed nucleoporins. Nup116, identified only in fungi, plays a central role in both protein import and mRNA export through the NPC. Nup116 is a modular protein with N-terminal FG repeats containing a Gle2p-binding sequence motif and a NPC targeting domain at its C-terminus. We report the crystal structure of the NPC targeting domain of Candida glabrata Nup116, consisting of residues 8821034 [CgNup116(8821034)], at 1.94 angstrom resolution. The X-ray structure of CgNup116(8821034) is consistent with the molecular envelope determined in solution by small-angle X-ray scattering. Structural similarities of CgNup116(8821034) with homologous domains from Saccharomyces cerevisiae Nup116, S. cerevisiae Nup145N, and human Nup98 are discussed. Proteins 2012; (c) 2012 Wiley Periodicals, Inc.

Protein arginine methyltransferases (PRMTs) play important roles in several cellular processes, including signaling, gene regulation, and transport of proteins and nucleic acids, to impact growth, differentiation, proliferation, and development. PRMT5 symmetrically di-methylates the two-terminal ω-guanidino nitrogens of arginine residues on substrate proteins. PRMT5 acts as part of a multimeric complex in concert with a variety of partner proteins that regulate its function and specificity. A core component of these complexes is the WD40 protein MEP50/WDR77/p44, which mediates interactions with binding partners and substrates. We have determined the crystal structure of human PRMT5 in complex with MEP50 (methylosome protein 50), bound to an S-adenosylmethionine analog and a peptide substrate derived from histone H4. The structure of the surprising hetero-octameric complex reveals the close interaction between the seven-bladed β-propeller MEP50 and the N-terminal domain of PRMT5, and delineates the structural elements of substrate recognition.

MicrosymposiaC46 robust mechanized experimental hardware, a flexible instrumentation control system with an intuitive user interface [1] and efficient integration of data collection and data analysis.A key component of the system is the Stanford Auto-Mounter (SAM), which can mount 198 samples without any manual intervention [2].The robot, in combination with other automated tasks, allow crystallography experiments to be carried out from the researchers' home institutions and other remote locations while retaining complete control over the experiment.Full remote access was implemented in 2005.Currently close to 80% of the user groups collect data totally remotely [3].Remote access to the SSRL computers is done via the NX client application provided by NoMachine, which provides a response close to that obtained at the beamline when a broadband connection is used.In addition, a web application, Web-Ice, can be used to analyze test diffraction images, calculate data collection strategy and carry out data processing [4].The latest efforts have focused on developing specialized workflows to fully automate highly iterative experiments (such as fragment-based drug search or mutant comparisons).To achieve this goal, a declarative programming language, RestFlow, has been developed.RestFlow facilitates the integration and sharing of scripts and programs by different workflows.Currently, a workflow automating all the steps from sample screening and selection to model refinement is under development.

Proteins: Structure, Function, and BioinformaticsVolume 79, Issue 5 p. 1672-1677 Structure Note Structure of the C-terminal domain of Saccharomyces cerevisiae Nup133, a component of the nuclear pore complex Parthasarathy Sampathkumar, Corresponding Author Parthasarathy Sampathkumar spartha2@gmail.com New York SGX Research Center for Structural Genomics, (NYSGXRC), Eli Lilly and Company, Lilly Biotechnology Center, San Diego, California 92121Lilly Biotechnology Center, 10300 Campus Point Drive, Suite 200, San Diego, CA 92121, USA===Search for more papers by this authorTarun Gheyi, Tarun Gheyi New York SGX Research Center for Structural Genomics, (NYSGXRC), Eli Lilly and Company, Lilly Biotechnology Center, San Diego, California 92121Search for more papers by this authorStacy A. Miller, Stacy A. Miller New York SGX Research Center for Structural Genomics, (NYSGXRC), Eli Lilly and Company, Lilly Biotechnology Center, San Diego, California 92121Search for more papers by this authorKevin T. Bain, Kevin T. Bain New York SGX Research Center for Structural Genomics, (NYSGXRC), Eli Lilly and Company, Lilly Biotechnology Center, San Diego, California 92121Search for more papers by this authorMark Dickey, Mark Dickey New York SGX Research Center for Structural Genomics, (NYSGXRC), Eli Lilly and Company, Lilly Biotechnology Center, San Diego, California 92121Search for more papers by this authorJeffrey B. Bonanno, Jeffrey B. Bonanno Department of Biochemistry, Albert Einstein College of Medicine, Bronx, New York 10461Search for more papers by this authorSeung Joong Kim, Seung Joong Kim Department of Bioengineering and Therapeutic Sciences, University of California, San Francisco, California 94158 Department of Pharmaceutical Chemistry, University of California, San Francisco, California 94158 California Institute for Quantitative Biosciences, University of California, San Francisco, California 94158Search for more papers by this authorJeremy Phillips, Jeremy Phillips Department of Bioengineering and Therapeutic Sciences, University of California, San Francisco, California 94158 Department of Pharmaceutical Chemistry, University of California, San Francisco, California 94158 California Institute for Quantitative Biosciences, University of California, San Francisco, California 94158 Graduate Group in Biological and Medical Informatics, University of California, San Francisco, California 94158Search for more papers by this authorUrsula Pieper, Ursula Pieper Department of Bioengineering and Therapeutic Sciences, University of California, San Francisco, California 94158 Department of Pharmaceutical Chemistry, University of California, San Francisco, California 94158 California Institute for Quantitative Biosciences, University of California, San Francisco, California 94158Search for more papers by this authorJavier Fernandez-Martinez, Javier Fernandez-Martinez Laboratory of Cellular and Structural Biology, The Rockefeller University, New York, New York 10065Search for more papers by this authorJosef D. Franke, Josef D. Franke Laboratory of Cellular and Structural Biology, The Rockefeller University, New York, New York 10065Search for more papers by this authorAnne Martel, Anne Martel Stanford Synchrotron Radiation Lightsource, Stanford Linear Accelerator Center, MS 69, Menlo Park, California 94025-7015Search for more papers by this authorHiro Tsuruta, Hiro Tsuruta Stanford Synchrotron Radiation Lightsource, Stanford Linear Accelerator Center, MS 69, Menlo Park, California 94025-7015Search for more papers by this authorShane Atwell, Shane Atwell New York SGX Research Center for Structural Genomics, (NYSGXRC), Eli Lilly and Company, Lilly Biotechnology Center, San Diego, California 92121Search for more papers by this authorDevon A. Thompson, Devon A. Thompson New York SGX Research Center for Structural Genomics, (NYSGXRC), Eli Lilly and Company, Lilly Biotechnology Center, San Diego, California 92121Search for more papers by this authorJ. Spencer Emtage, J. Spencer Emtage New York SGX Research Center for Structural Genomics, (NYSGXRC), Eli Lilly and Company, Lilly Biotechnology Center, San Diego, California 92121Search for more papers by this authorStephen R. Wasserman, Stephen R. Wasserman LRL-CAT, Eli Lilly and Company, Advanced Photon Source, Argonne National Laboratory, Illinois 60439Search for more papers by this authorMichael P. Rout, Michael P. Rout Laboratory of Cellular and Structural Biology, The Rockefeller University, New York, New York 10065Search for more papers by this authorAndrej Sali, Andrej Sali Department of Bioengineering and Therapeutic Sciences, University of California, San Francisco, California 94158 Department of Pharmaceutical Chemistry, University of California, San Francisco, California 94158 California Institute for Quantitative Biosciences, University of California, San Francisco, California 94158Search for more papers by this authorJ. Michael Sauder, J. Michael Sauder New York SGX Research Center for Structural Genomics, (NYSGXRC), Eli Lilly and Company, Lilly Biotechnology Center, San Diego, California 92121Search for more papers by this authorStephen K. Burley, Stephen K. Burley New York SGX Research Center for Structural Genomics, (NYSGXRC), Eli Lilly and Company, Lilly Biotechnology Center, San Diego, California 92121Search for more papers by this author Parthasarathy Sampathkumar, Corresponding Author Parthasarathy Sampathkumar spartha2@gmail.com New York SGX Research Center for Structural Genomics, (NYSGXRC), Eli Lilly and Company, Lilly Biotechnology Center, San Diego, California 92121Lilly Biotechnology Center, 10300 Campus Point Drive, Suite 200, San Diego, CA 92121, USA===Search for more papers by this authorTarun Gheyi, Tarun Gheyi New York SGX Research Center for Structural Genomics, (NYSGXRC), Eli Lilly and Company, Lilly Biotechnology Center, San Diego, California 92121Search for more papers by this authorStacy A. Miller, Stacy A. Miller New York SGX Research Center for Structural Genomics, (NYSGXRC), Eli Lilly and Company, Lilly Biotechnology Center, San Diego, California 92121Search for more papers by this authorKevin T. Bain, Kevin T. Bain New York SGX Research Center for Structural Genomics, (NYSGXRC), Eli Lilly and Company, Lilly Biotechnology Center, San Diego, California 92121Search for more papers by this authorMark Dickey, Mark Dickey New York SGX Research Center for Structural Genomics, (NYSGXRC), Eli Lilly and Company, Lilly Biotechnology Center, San Diego, California 92121Search for more papers by this authorJeffrey B. Bonanno, Jeffrey B. Bonanno Department of Biochemistry, Albert Einstein College of Medicine, Bronx, New York 10461Search for more papers by this authorSeung Joong Kim, Seung Joong Kim Department of Bioengineering and Therapeutic Sciences, University of California, San Francisco, California 94158 Department of Pharmaceutical Chemistry, University of California, San Francisco, California 94158 California Institute for Quantitative Biosciences, University of California, San Francisco, California 94158Search for more papers by this authorJeremy Phillips, Jeremy Phillips Department of Bioengineering and Therapeutic Sciences, University of California, San Francisco, California 94158 Department of Pharmaceutical Chemistry, University of California, San Francisco, California 94158 California Institute for Quantitative Biosciences, University of California, San Francisco, California 94158 Graduate Group in Biological and Medical Informatics, University of California, San Francisco, California 94158Search for more papers by this authorUrsula Pieper, Ursula Pieper Department of Bioengineering and Therapeutic Sciences, University of California, San Francisco, California 94158 Department of Pharmaceutical Chemistry, University of California, San Francisco, California 94158 California Institute for Quantitative Biosciences, University of California, San Francisco, California 94158Search for more papers by this authorJavier Fernandez-Martinez, Javier Fernandez-Martinez Laboratory of Cellular and Structural Biology, The Rockefeller University, New York, New York 10065Search for more papers by this authorJosef D. Franke, Josef D. Franke Laboratory of Cellular and Structural Biology, The Rockefeller University, New York, New York 10065Search for more papers by this authorAnne Martel, Anne Martel Stanford Synchrotron Radiation Lightsource, Stanford Linear Accelerator Center, MS 69, Menlo Park, California 94025-7015Search for more papers by this authorHiro Tsuruta, Hiro Tsuruta Stanford Synchrotron Radiation Lightsource, Stanford Linear Accelerator Center, MS 69, Menlo Park, California 94025-7015Search for more papers by this authorShane Atwell, Shane Atwell New York SGX Research Center for Structural Genomics, (NYSGXRC), Eli Lilly and Company, Lilly Biotechnology Center, San Diego, California 92121Search for more papers by this authorDevon A. Thompson, Devon A. Thompson New York SGX Research Center for Structural Genomics, (NYSGXRC), Eli Lilly and Company, Lilly Biotechnology Center, San Diego, California 92121Search for more papers by this authorJ. Spencer Emtage, J. Spencer Emtage New York SGX Research Center for Structural Genomics, (NYSGXRC), Eli Lilly and Company, Lilly Biotechnology Center, San Diego, California 92121Search for more papers by this authorStephen R. Wasserman, Stephen R. Wasserman LRL-CAT, Eli Lilly and Company, Advanced Photon Source, Argonne National Laboratory, Illinois 60439Search for more papers by this authorMichael P. Rout, Michael P. Rout Laboratory of Cellular and Structural Biology, The Rockefeller University, New York, New York 10065Search for more papers by this authorAndrej Sali, Andrej Sali Department of Bioengineering and Therapeutic Sciences, University of California, San Francisco, California 94158 Department of Pharmaceutical Chemistry, University of California, San Francisco, California 94158 California Institute for Quantitative Biosciences, University of California, San Francisco, California 94158Search for more papers by this authorJ. Michael Sauder, J. Michael Sauder New York SGX Research Center for Structural Genomics, (NYSGXRC), Eli Lilly and Company, Lilly Biotechnology Center, San Diego, California 92121Search for more papers by this authorStephen K. Burley, Stephen K. Burley New York SGX Research Center for Structural Genomics, (NYSGXRC), Eli Lilly and Company, Lilly Biotechnology Center, San Diego, California 92121Search for more papers by this author First published: 04 January 2011 https://doi.org/10.1002/prot.22973Citations: 15Read the full textAboutPDF ToolsRequest permissionExport citationAdd to favoritesTrack citation ShareShare Give accessShare full text accessShare full-text accessPlease review our Terms and Conditions of Use and check box below to share full-text version of article.I have read and accept the Wiley Online Library Terms and Conditions of UseShareable LinkUse the link below to share a full-text version of this article with your friends and colleagues. Learn more.Copy URL Share a linkShare onFacebookTwitterLinked InRedditWechat Citing Literature Volume79, Issue5May 2011Pages 1672-1677 RelatedInformation

Plants and microorganisms reduce environmental inorganic nitrogen to ammonium, which then enters various metabolic pathways solely via conversion of 2-oxoglutarate (2OG) to glutamate and glutamine. Cellular 2OG concentrations increase during nitrogen starvation. We recently identified a family of 2OG-sensing proteins the nitrogen regulatory protein NrpR that bind DNA and repress transcription of nitrogen assimilation genes. We used X-ray crystallography to determine the structure of NrpR regulatory domain. We identified the NrpR 2OG-binding cleft and show that residues predicted to interact directly with 2OG are conserved among diverse classes of 2OG-binding proteins. We show that high levels of 2OG inhibit NrpRs ability to bind DNA. Electron microscopy analyses document that NrpR adopts different quaternary structures in its inhibited 2OG-bound state compared with its active apo state. Our results indicate that upon 2OG release, NrpR repositions its DNA-binding domains correctly for optimal interaction with DNA thereby enabling gene repression.

Proteins: Structure, Function, and BioinformaticsVolume 78, Issue 14 p. 3056-3062 Structure Note Structure of a putative BenF-like porin from Pseudomonas fluorescens Pf-5 at 2.6 Å resolution Parthasarathy Sampathkumar, Corresponding Author Parthasarathy Sampathkumar [email protected] New York SGX Research Center for Structural Genomics (NYSGXRC). Eli Lilly and Company, Lilly Biotechnology Center, San Diego, California 92121Eli Lilly and Company, 10300 Campus Point Drive, Suite 200, San Diego, CA 92121===Search for more papers by this authorFrances Lu, Frances Lu New York SGX Research Center for Structural Genomics (NYSGXRC). Eli Lilly and Company, Lilly Biotechnology Center, San Diego, California 92121Search for more papers by this authorXun Zhao, Xun Zhao New York SGX Research Center for Structural Genomics (NYSGXRC). Eli Lilly and Company, Lilly Biotechnology Center, San Diego, California 92121Search for more papers by this authorZhenzhen Li, Zhenzhen Li New York SGX Research Center for Structural Genomics (NYSGXRC). Eli Lilly and Company, Lilly Biotechnology Center, San Diego, California 92121Search for more papers by this authorJeremiah Gilmore, Jeremiah Gilmore New York SGX Research Center for Structural Genomics (NYSGXRC). Eli Lilly and Company, Lilly Biotechnology Center, San Diego, California 92121Search for more papers by this authorKevin Bain, Kevin Bain New York SGX Research Center for Structural Genomics (NYSGXRC). Eli Lilly and Company, Lilly Biotechnology Center, San Diego, California 92121Search for more papers by this authorMarc E. Rutter, Marc E. Rutter New York SGX Research Center for Structural Genomics (NYSGXRC). Eli Lilly and Company, Lilly Biotechnology Center, San Diego, California 92121Search for more papers by this authorTarun Gheyi, Tarun Gheyi New York SGX Research Center for Structural Genomics (NYSGXRC). Eli Lilly and Company, Lilly Biotechnology Center, San Diego, California 92121Search for more papers by this authorKenneth D. Schwinn, Kenneth D. Schwinn New York SGX Research Center for Structural Genomics (NYSGXRC). Eli Lilly and Company, Lilly Biotechnology Center, San Diego, California 92121Search for more papers by this authorJeffrey B. Bonanno, Jeffrey B. Bonanno Department of Biochemistry, Albert Einstein College of Medicine, Bronx, New York 10461Search for more papers by this authorUrsula Pieper, Ursula Pieper Department of Bioengineering and Therapeutic Sciences, University of California, San Francisco, California 94158 Department of Pharmaceutical Chemistry, University of California, San Francisco, California 94158 California Institute for Quantitative Biosciences, University of California, San Francisco, 94158Search for more papers by this authorJ. Eduardo Fajardo, J. Eduardo Fajardo Department of Biochemistry, Albert Einstein College of Medicine, Bronx, New York 10461 Department of Systems and Computational Biology, Albert Einstein College of Medicine, Bronx, NY 10461Search for more papers by this authorAndras Fiser, Andras Fiser Department of Biochemistry, Albert Einstein College of Medicine, Bronx, New York 10461 Department of Systems and Computational Biology, Albert Einstein College of Medicine, Bronx, NY 10461Search for more papers by this authorSteven C. Almo, Steven C. Almo Department of Biochemistry, Albert Einstein College of Medicine, Bronx, New York 10461Search for more papers by this authorSubramanyam Swaminathan, Subramanyam Swaminathan Department of Biology, Brookhaven National Laboratory, Upton, New York 11973Search for more papers by this authorMark R. Chance, Mark R. Chance Department of Physiology and Biophysics, Center for Proteomics and Bioinformatics, Case Western Reserve University, Cleveland, Ohio 44106Search for more papers by this authorDavid Baker, David Baker Department of Biochemistry, University of Washington, Seattle, Washington 98195Search for more papers by this authorShane Atwell, Shane Atwell New York SGX Research Center for Structural Genomics (NYSGXRC). Eli Lilly and Company, Lilly Biotechnology Center, San Diego, California 92121Search for more papers by this authorDevon A. Thompson, Devon A. Thompson New York SGX Research Center for Structural Genomics (NYSGXRC). Eli Lilly and Company, Lilly Biotechnology Center, San Diego, California 92121Search for more papers by this authorJ. Spencer Emtage, J. Spencer Emtage New York SGX Research Center for Structural Genomics (NYSGXRC). Eli Lilly and Company, Lilly Biotechnology Center, San Diego, California 92121Search for more papers by this authorStephen R. Wasserman, Stephen R. Wasserman LRL-CAT, Eli Lilly and Company, Advanced Photon Source, Argonne National Laboratory, Argonne, Illinois 60439Search for more papers by this authorAndrej Sali, Andrej Sali Department of Bioengineering and Therapeutic Sciences, University of California, San Francisco, California 94158 Department of Pharmaceutical Chemistry, University of California, San Francisco, California 94158 California Institute for Quantitative Biosciences, University of California, San Francisco, 94158Search for more papers by this authorJ. Michael Sauder, J. Michael Sauder New York SGX Research Center for Structural Genomics (NYSGXRC). Eli Lilly and Company, Lilly Biotechnology Center, San Diego, California 92121Search for more papers by this authorStephen K. Burley, Stephen K. Burley New York SGX Research Center for Structural Genomics (NYSGXRC). Eli Lilly and Company, Lilly Biotechnology Center, San Diego, California 92121Search for more papers by this author Parthasarathy Sampathkumar, Corresponding Author Parthasarathy Sampathkumar [email protected] New York SGX Research Center for Structural Genomics (NYSGXRC). Eli Lilly and Company, Lilly Biotechnology Center, San Diego, California 92121Eli Lilly and Company, 10300 Campus Point Drive, Suite 200, San Diego, CA 92121===Search for more papers by this authorFrances Lu, Frances Lu New York SGX Research Center for Structural Genomics (NYSGXRC). Eli Lilly and Company, Lilly Biotechnology Center, San Diego, California 92121Search for more papers by this authorXun Zhao, Xun Zhao New York SGX Research Center for Structural Genomics (NYSGXRC). Eli Lilly and Company, Lilly Biotechnology Center, San Diego, California 92121Search for more papers by this authorZhenzhen Li, Zhenzhen Li New York SGX Research Center for Structural Genomics (NYSGXRC). Eli Lilly and Company, Lilly Biotechnology Center, San Diego, California 92121Search for more papers by this authorJeremiah Gilmore, Jeremiah Gilmore New York SGX Research Center for Structural Genomics (NYSGXRC). Eli Lilly and Company, Lilly Biotechnology Center, San Diego, California 92121Search for more papers by this authorKevin Bain, Kevin Bain New York SGX Research Center for Structural Genomics (NYSGXRC). Eli Lilly and Company, Lilly Biotechnology Center, San Diego, California 92121Search for more papers by this authorMarc E. Rutter, Marc E. Rutter New York SGX Research Center for Structural Genomics (NYSGXRC). Eli Lilly and Company, Lilly Biotechnology Center, San Diego, California 92121Search for more papers by this authorTarun Gheyi, Tarun Gheyi New York SGX Research Center for Structural Genomics (NYSGXRC). Eli Lilly and Company, Lilly Biotechnology Center, San Diego, California 92121Search for more papers by this authorKenneth D. Schwinn, Kenneth D. Schwinn New York SGX Research Center for Structural Genomics (NYSGXRC). Eli Lilly and Company, Lilly Biotechnology Center, San Diego, California 92121Search for more papers by this authorJeffrey B. Bonanno, Jeffrey B. Bonanno Department of Biochemistry, Albert Einstein College of Medicine, Bronx, New York 10461Search for more papers by this authorUrsula Pieper, Ursula Pieper Department of Bioengineering and Therapeutic Sciences, University of California, San Francisco, California 94158 Department of Pharmaceutical Chemistry, University of California, San Francisco, California 94158 California Institute for Quantitative Biosciences, University of California, San Francisco, 94158Search for more papers by this authorJ. Eduardo Fajardo, J. Eduardo Fajardo Department of Biochemistry, Albert Einstein College of Medicine, Bronx, New York 10461 Department of Systems and Computational Biology, Albert Einstein College of Medicine, Bronx, NY 10461Search for more papers by this authorAndras Fiser, Andras Fiser Department of Biochemistry, Albert Einstein College of Medicine, Bronx, New York 10461 Department of Systems and Computational Biology, Albert Einstein College of Medicine, Bronx, NY 10461Search for more papers by this authorSteven C. Almo, Steven C. Almo Department of Biochemistry, Albert Einstein College of Medicine, Bronx, New York 10461Search for more papers by this authorSubramanyam Swaminathan, Subramanyam Swaminathan Department of Biology, Brookhaven National Laboratory, Upton, New York 11973Search for more papers by this authorMark R. Chance, Mark R. Chance Department of Physiology and Biophysics, Center for Proteomics and Bioinformatics, Case Western Reserve University, Cleveland, Ohio 44106Search for more papers by this authorDavid Baker, David Baker Department of Biochemistry, University of Washington, Seattle, Washington 98195Search for more papers by this authorShane Atwell, Shane Atwell New York SGX Research Center for Structural Genomics (NYSGXRC). Eli Lilly and Company, Lilly Biotechnology Center, San Diego, California 92121Search for more papers by this authorDevon A. Thompson, Devon A. Thompson New York SGX Research Center for Structural Genomics (NYSGXRC). Eli Lilly and Company, Lilly Biotechnology Center, San Diego, California 92121Search for more papers by this authorJ. Spencer Emtage, J. Spencer Emtage New York SGX Research Center for Structural Genomics (NYSGXRC). Eli Lilly and Company, Lilly Biotechnology Center, San Diego, California 92121Search for more papers by this authorStephen R. Wasserman, Stephen R. Wasserman LRL-CAT, Eli Lilly and Company, Advanced Photon Source, Argonne National Laboratory, Argonne, Illinois 60439Search for more papers by this authorAndrej Sali, Andrej Sali Department of Bioengineering and Therapeutic Sciences, University of California, San Francisco, California 94158 Department of Pharmaceutical Chemistry, University of California, San Francisco, California 94158 California Institute for Quantitative Biosciences, University of California, San Francisco, 94158Search for more papers by this authorJ. Michael Sauder, J. Michael Sauder New York SGX Research Center for Structural Genomics (NYSGXRC). Eli Lilly and Company, Lilly Biotechnology Center, San Diego, California 92121Search for more papers by this authorStephen K. Burley, Stephen K. Burley New York SGX Research Center for Structural Genomics (NYSGXRC). Eli Lilly and Company, Lilly Biotechnology Center, San Diego, California 92121Search for more papers by this author First published: 08 September 2010 https://doi.org/10.1002/prot.22829Citations: 17Read the full textAboutPDF ToolsRequest permissionExport citationAdd to favoritesTrack citation ShareShare Give accessShare full text accessShare full-text accessPlease review our Terms and Conditions of Use and check box below to share full-text version of article.I have read and accept the Wiley Online Library Terms and Conditions of UseShareable LinkUse the link below to share a full-text version of this article with your friends and colleagues. Learn more.Copy URL Share a linkShare onEmailFacebookTwitterLinkedInRedditWechat Supporting Information Additional Supporting Information may be found in the online version of this article. Filename Description PROT_22829_sm_suppinfo.doc35.5 KB Supporting Information PROT_22829_sm_suppfig.tif3.3 MB Supporting Figure Please note: The publisher is not responsible for the content or functionality of any supporting information supplied by the authors. Any queries (other than missing content) should be directed to the corresponding author for the article. REFERENCES 1 Nikaido H. Molecular basis of bacterial outer membrane permeability revisited. Microbiol Molbiol Rev 2003; 67: 593–656. 2 Hancock RE,Brinkman FS. Function of pseudomonas porins in uptake and efflux. Annu Rev Microbiol 2002; 56: 17–38. 3 Trias J,Nikaido H. Protein D2 channel of the Pseudomonas aeruginosa outer membrane has a binding site for basic amino acids and peptides. J Biol Chem 2006; 265: 15680–15684. 4 Tamber S,Ochs MM,Hancock RE. Role of the novel OprD family of porins in nutrient uptake in Pseudomonas aeruginosa. J Bacteriol 2006; 188: 45–54. 5 Cowles CE,Nichols NN,Harwood CS. BenR, a XylS homologue, regulates three different pathways of aromatic acid degradation in Pseudomonas putida. J Bacterol 2000; 182: 6339–6346. 6 Nishikawa Y,Yasumi Y,Noguchi S,Sakamoto H,Nikawa J. Functional analyses of Pseudomonas putida benzoate transporters expressed in the yeast Saccharomyces cerevisiae. Biosci Biotechnol Biochem 2008; 72: 2034–2038. 7 Altschul SF,Madden TL,Schaffer AA,Zhang J,Zhang Z,Miller W,Lipman DJ. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res 1997; 25: 3389–3402. 8 The UniProt Consortium. The universal protein resource (UniProt) in 2010. Nucleic Acids Res 2010; 38(Database issue): D142–D148. 9 Paulsen IT,Press CM,Ravel J,Kobayashi DY,Myers GS,Mavrodi DV,De Boy RT,Seshadri R,Ren Q,Madupu R,Dodson RJ,Durkin AS,Brinkac LM,Daugherty SC,Sullivan SA,Rosovitz MJ,Gwinn ML,Zhou L,Schneider DJ,Cartinhour SW,Nelson WC,Weidman J,Watkins K,Tran K,Khouri H,Pierson EA,Pierson LS,III,Thomashow LS,Loper JE. Complete genome sequence of the plant commensal Pseudomonas fluorescens Pf-5. Nat Biotechnol 2005; 23: 873–878. 10 Nelson KE,Weinel C,Paulsen IT,Dodson RJ,Hilbert H,Martins dos Santos VA,Fouts DE,Gill SR,Pop M,Holmes M,Brinkac L,Beanan M,DeBoy RT,Daugherty S,Kolonay J,Madupu R,Nelson W,White O,Peterson J,Khouri H,Hance I,Chris Lee P,Holtzapple E,Scanlan D,Tran K,Moazzez A,Utterback T,Rizzo M,Lee K,Kosack D,Moestl D,Wedler H,Lauber J,Stjepandic D,Hoheisel J,Straetz M,Heim S,Kiewitz C,Eisen JA,Timmis KN,Düsterhöft A,Tümmler B,Fraser CM. Complete genome sequence and comparative analysis of the metabolically versatile Pseudomonas putida KT2440. Environ Microbiol 2002; 4: 799–808. 11 Biswas S,Mohammad MM,Patel DR,Movileanu L,van den Berg B. Structural insight into OprD substrate specificity. Nat Struct Mol Biol 2007; 14: 1108–1109. 12 Biswas S,Mohammad MM,Movileanu L,van den Berg B. Crystal structure of the outer membrane protein OpdK from Pseudomonas aeruginosa. Structure 2008; 16: 1027–1035. 13 Sambrook J,Fritsch EF,Maniatis T. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbour, NY: Cold Spring Harbour Laboratory; 1989. 14 Leslie AGW,Brick P,Wonacott AJ. An improved program package for the measurement of oscillation photographs. CCP4 News Lett 1986; 18: 33–39. 15 Collaborative Computing Project Number 4. The CCP4 suite: programs for protein crystallography. Acta Crystallog Sect D Biol Crystallogr 1994; 50: 760–763. 16 McCoy AJ,Grosse-Kunstleve RW,Adams PD,Winn MD,Storoni L,Read RJ. Phaser crystallographic software. J Appl Cryst 2007; 40: 658–674. 17 Emsley P,Cowtan K. COOT: model-building tools for molecular graphics. Acta Crystallogr Sect D Biol Crystallogr 2004; 60: 2126–2132. 18 Murshudov GN,Vagin AA,Dodson EJ. Refinement of macromolecular structures by the Maximum-Likelihood Method. Acta Crystallogr D Biol Crystallogr 1997; 53: 240–255. 19 Ramakrishnan C,Ramachandran GN. Stereochemical criteria for polypeptide and protein chain conformations. II. Allowed conformations for a pair of peptide units. Biophys J 1965; 5: 909–933. 20 Davis IW,Leaver-Fay A,Chen VB,Block JN,Kapral GJ,Wang X,Murray LW,Arendall WB,III,Snoeyink J,Richardson JS,Richardson DC. Mol Probity: all-atom contacts and structure validation for proteins and nucleic acids. Nucl Acids Res 2007; 35: W375–W383. 21 Smart OS,Neduvelil JG,Wang X,Wallace BA,Sansom MSP. HOLE: a program for the analysis of the pore dimensions of ion channel structural models. J Mol Graph 1996; 14: 354–360. 22 Larkin MA,Blackshields G,Brown NP,Chenna R,McGettigan PA,McWilliam H,Valentin F,Wallace IM,Wilm A,Lopez R,Thompson JD,Gibson TJ,Higgins DG. ClustalW and ClustalX version 2. Bioinformatics 2007; 23: 2947–2948. 23 Gouet P,Courcelle E,Stuart DI,Metoz F. ESPript: multiple sequence alignments in PostScript. Bioinformatics 1999; 15: 305–308. 24 Krissinel E,Henrick K. Secondary-structure matching (SSM), a new tool for fast protein structure alignment in three dimensions. Acta Crystallogr D Biol Crystallogr 2004; 60: 2256–2268. 25 Schulz GE. The structure of bacterial outer membrane proteins. Biochim Biophys Acta 2002; 1565: 308–317. 26 Eswar N,John B,Mirkovic N,Fiser A,Ilyin VA,Pieper U,Stuart AC,Marti-Renom MA,Madhusudhan MS,Yerkovich B,Sali A. Tools for comparative protein structure modeling and analysis. Nucleic Acids Res 2003; 31: 3375–3380. 27 Pieper U,Eswar N,Webb BM,Eramian D,Kelly L,Barkan DT,Carter H,Mankoo P,Karchin R,Marti-Renom MA,Davis FP,Sali A. MODBASE, a database of annotated comparative protein structure models and associated resources. Nucleic Acids Res 2009; 37: D347–354. Citing Literature Volume78, Issue141 November 2010Pages 3056-3062 ReferencesRelatedInformation

Nuclear pore complexes (NPCs) are large, octagonally symmetric dynamic macromolecular assemblies responsible for exchange of proteins and RNAs between the nucleus and cytoplasm. NPCs are made up of at least 456 polypetides from ∼30 distinct nucleoporins.1, 2 Several of these components, sharing similar structural motifs, form stable subcomplexes that form a coaxial structure containing two outer rings (the nuclear and cytoplasmic rings), two inner rings, and a membrane ring.3, 4 The yeast (Saccharomyces cerevisiae) Nup145 and its human counterpart are unique among the nucleoporins, in that they undergo autoproteolysis to generate functionally distinct proteins.5-9 The human counterpart of Nup145 is expressed as two alternatively spliced mRNA transcripts. The larger 190 kDa precursor undergoes post-translational autoproteolysis at the Phe863-Ser864 peptide bond yielding the 92 kDa Nup98 and the 96 kDa Nup96.8, 9 The smaller 98 kDa precursor is also autoproteolysed at an analogous site giving 92 kDa Nup98-N and a 6 kDa C-terminal fragment, which may form a noncovalent complex.10, 11 The yeast Nup145 precursor [Fig. 1(A)] contains twelve repeats of a "GLFG" peptide motif (FG repeats) at its N-terminus, an internal autoproteolytic domain (a region of high conservation with the homologous yeast nucleoporins Nup110 and Nup116, neither of which undergo autoproteolysis), followed by the C-terminal domain.5 Various forms of the FG repeats are present in nearly half of all nucleoporins; they form intrinsically disordered regions implicated in gating mechanisms that control passage of macromolecules through NPCs.12 Nup145 undergoes autoproteolysis at the Phe605-Ser606 peptide bond to generate two functionally distinct proteins, Nup145N and Nup145C.6, 7 Subsequently, Nup145C associates with six other proteins to form the heptameric Y-complex,13 a component of the outer rings of the NPC.3, 4 Nup145N, on the other hand, can shuttle between the NPC and the nuclear interior. It has been suggested that Nup145N, by analogy with Nup98, carries RNA between the nucleus and the NPC.14, 15 Nup145 belongs to a highly conserved family of homologs found throughout eukarya. Curiously, the Phe-Ser autoproteolytic site is not always conserved, resulting in the absence of autoproteolysis for some of these closely related proteins.16, 17 A: Schematic representation of the S. cerevisiae Nup145 protein. The "FG" repeats are shaded in blue and the expression construct boundaries of Nup145N(443–605) delimited in gray. The site of autoproteolysis is marked with a red triangle. B: Stereoview of the Nup145N(443–605) monomer. Cartoon of Chain B is shown as a rainbow from blue to red from N- to C-terminus. C: Stereoview of the Nup145N(443–605) head-to-tail dimer seen in the tetragonal crystals. Cartoons of Chains A and B are shown in gray and green, respectively. Residues involved in dimeric interactions from Chain B are colored in blue and those from Chain A are colored in red. D: Stereoview of the superposition of Nup145N(443–605) dimers from two different crystal forms. Nup145N(443–605) forms an identical dimer in both tetragonal and hexagonal crystal forms. The A and B chains of tetragonal form are shown as gray and green ribbons, respectively. Similarly, A and B chains of the hexagonal forms are shown in yellow and wheat, respectively. All structural superpositions were carried out using SSM.18 Our structural understanding of NPC function has benefited recently from X-ray crystal structures of segments of individual proteins.19 As a part of ongoing efforts at the New York SGX Research Center for Structural Genomics (www.nysgxrc.org) to determine crystal structures of distinct components of the yeast NPC, we report herein structures of Nup145N residues 443–605 [Nup145N(443–605)] from the larger autoproteolytic segment. The monomeric architecture of Nup145N(443–605) is similar to that of the autoproteolytic domain of human Nup98-N and the homologous domain of Nup116. In contrast, Nup145N(443–605) and Nup98-N show different modes of association in the crystalline state. Results of Small Angle X-ray Scattering (SAXS) in solution are consistent with the head-to-tail dimer of Nup145N(443–605), observed in two different crystal forms. The gene encoding Nup145N from Saccharomyces cerevisiae was cloned from the genomic DNA of the yeast strain Sc2601D-5 (American Type Culture Collection). The desired truncation (encoding residues 443–605) was PCR amplified using AATAAACAAGACGGCGAAAATAC and CAAAATGATTGACTTTGAAAGTCC as forward and reverse primers, respectively. The purified PCR product was subsequently TOPO® (Invitrogen) cloned into pSGX3, a derivative of pET26b(+), giving rise to a protein with a noncleavable C-terminal hexa-histidine tag. The resulting plasmid was transformed into BL21(DE3)-Condon+RIL (Invitrogen) cells for overexpression. Production of Se-Met protein was carried out in 1L of HY media at 22°C containing 50 μg/mL of kanamycin and 35 μg/mL of chloramphenicol. Protein expression was induced by addition of 0.4 mM IPTG. Cells were harvested after 21 h by centrifugation at 4°C. For purification, the E. coli cell pellet was resuspended in 30 mL of cold buffer containing 20 mM Tris HCl pH 8.0, 500 mM NaCl, 25 mM imidazole, and 0.1% (v/v) Tween 20 and cells were lysed via sonication. Debris was removed by centrifugation at 4°C. The decanted supernatant was applied to a 5 mL HisTrapHP column (GE Health Care) charged with nickel and pre-equilibrated with 20 mM Tris HCl (pH 8.0), 500 mM NaCl, 10% (v/v) glycerol, and 25 mM imidazole. The sample was washed with 5 column volumes (CV) of 20 mM Tris HCl (pH 8.0), 500 mM NaCl, 10% (v/v) glycerol, and 40 mM imidazole, and subsequently eluted with 2 CV of same buffer with an imidazole concentration of 250 mM. Eluted protein was passed over a 120 mL Superdex 200 size exclusion column equilibrated with 10 mM HEPES pH 7.5, 150 mM NaCl, 10% (v/v) glycerol, and 5 mM DTT (protein storage buffer). SDS-PAGE analysis showed greater than 95% purity and protein fractions corresponding to the symmetric portion of the size exclusion chromatography profile were pooled for concentration with AMICON spin filters. Concentrated protein aliquots were frozen in liquid nitrogen and stored at −80°C. Nup145N(443–605) was subjected to crystallization screening with the Classics, Classics II, and PEGs kits (Qiagen) using a Phoenix Liquid Handling System (Art Robins) via sitting drop vapor diffusion at 21°C (11.8 mg/ml; 0.3 μL protein + 0.3 μL reservoir solution). Tetragonal crystals grew in 100 mM Hepes pH 7.5, 25% PEG 3350, and 200 mM sodium chloride (Classics II suite; condition number 72) and were cryoprotected by addition of ethylene glycol [final concentration ∼20% (v/v)] and flash frozen by immersion in liquid nitrogen. Hexagonal crystals were obtained in 1600 mM tri-sodium citrate dehydrate (Classics suite; condition number 45) and cryoprotected by addition of ethylene glycol [final concentration ∼20% (v/v)]. Diffraction data were recorded using the LRL-CAT 31-ID beamline at the Advanced Photon Source (APS) and processed with MOSFLM20 and SCALA (CCP4).21 Structures were determined independently following similar procedures. All eight expected Se atoms were located with SHELXD22 and phases were calculated using SHELXE as implemented in HKL2MAP.23 Initial model building was carried out with ARP/wARP,24 followed by manual rebuilding with COOT.25 Atomic models of Nup145N(443–605) refined to convergence using REFMAC526 show excellent stereochemistry (Table I). Structural analyses were carried out using COOT and CCP4 and illustrations were prepared using PyMol.27 SEC-MALLS was used to determine molecular weight in solution with an analytical gel filtration column (Wyatt Technologies-05S5; 7.8 mm × 300 mm; pore size = 150Å) connected to a binary LC pumping system (Agilent 1100), temperature controlled auto-sampler, a UV-visible detector, DAWN®-TREOSTM three-angle static light scattering detector (Wyatt Technology), and an Optilab® rEX differential refractometer equipped with a Peltier temperature-regulated flow cell, maintained at 25°C (Wyatt Technology, USA). The LC system and light scattering detector (LSD) was controlled by ChemStation (Agilent Technologies, USA) and Astra V software (Wyatt Technology), respectively. The column and LSD was pre-equilibrated with the protein storage buffer. The experiment was performed at room temperature at a flow rate of 0.5 mL/min for 40 min. Approximately 100 μg of Nup145N(443–605), at concentrations of 11.8, 22.7, and 46.0 mg/mL, were injected and monitored at a wavelength of 280 nm. The molecular mass from light scattering data was calculated using a specific refractive index increment (dn/dc) value of 0.183 mL/g that is universal for proteins. SAXS measurements of Nup145N(443–605) were carried out with Beamline 4–2 at the Stanford Synchrotron Radiation Lightsource (SSRL) and the SIBYLS Beamline 12.3.1 at the Advanced Light Source (ALS) yielding essentially identical results. At SSRL, we used an automatic sample delivery system equipped with a 1.5 mm diameter thin-wall quartz capillary within which a sample aliquot oscillated in the X-ray beam to minimize radiation damage. It was placed at 1.7 m from a Rayonix225 (MAR-USA) CCD detector with a binned pixel size of 293 μm × 293 μm. Ten 3-sec exposures were made for each protein sample maintained at 15°C. Each of the 10 diffraction images were scaled using the transmitted beam intensity, azimuthally integrated, and averaged to obtain fully processed data in the form of intensity versus q[q = 4πsin(θ)/λ, θ = one-half of the scattering angle; λ = X-ray wavelength]. The buffer profile was obtained in the same manner and subtracted from a protein profile. SAXS profiles of Nup145N(443–605) were recorded at protein concentrations of 0.5, 1.0, 2.0, 5.0, and 11.8 mg/mL in protein storage buffer. Moreover, mild concentration dependence was removed by extrapolating to the zero concentration. We merged the average of the lower scattering angle parts (q < 0.15Å−1) of the lower concentration profiles (0.5–2.0 mg/mL) and the average of the higher scattering angle parts (q > 0.12Å−1) of the higher concentration (5.0–11.8 mg/mL) profiles, to obtain the final, merged experimental SAXS profile. The shape of Nup145N(443–605) was calculated from this merged experimental SAXS profile by running DAMMIF30 10 times individually, followed by superposition and averaging with DAMAVER.31 The oligomeric state of Nup145N(443–605) was calculated from the merged experimental SAXS profile using OLIGOMER.32 The merged experimental SAXS profile was also compared with profiles calculated for the monomer (Chain B) and the crystallographic dimer of Nup145N(443–605) with IMP33 and CRYSOL.34 The crystal structure of Nup145N(443–605) has been determined at 1.82Å resolution [Fig. 1(B), Table I]. The tetragonal crystal form (P43212) has two molecules in the asymmetric unit. The B chain could be traced continuously from Phe459 to Phe605. In the A chain, residues 557–560 appear disordered. Otherwise, the A and B chains are very similar with a root mean square deviation (r.m.s.d.) of 0.4Å for 144 Cα atomic pairs. The structure of Nup145N(443–605) contains two antiparallel β-sheets capped by α-helices [Fig. 1(B)], as predicted based on its sequence similarity with Nup98.35 A six stranded β-sheet is formed by β1-β2-β3-β6-β8-β7 and a two stranded β-sheet is formed by β4-β5. Helices α1, α2, and α3 form a cap near the N-terminus and α4 caps the six stranded β-sheet near the C-terminus. Nup145N(443–605) possesses three long loops: L1 (between β3-β4), L2 (between β5-β6), and L3 (between β6-α4). Autoproteolysis of Nup145 occurs at the Phe605-Ser606 peptide bond.6, 7 Autoproteolytic events result from NO or NS acyl shift catalyzed by Ser/Thr or Cys side chains.36 In our structure, the Phe605-Ser606 bond is replaced by Phe605-Glu606 (Glu606 is a cloning artifact derived from the expression plasmid) and, thus, the electron density between Phe605 and Glu606 is continuous in both A and B chains. Nup145N(443–605) forms a tight dimer in the crystal [Fig. 1(C)]. An identical dimer of Nup145N(443–605) was observed in our hexagonal (P61) crystal form, the structure of which was independently determined with Se-Met experimental phases (Table I and [Fig. 1(D)]). Monomers of the tetragonal and hexagonal crystal forms superimposed well with r.m.s.d. = 0.37Å for 145 Cα atom pairs. The dimers are also very similar (r.m.s.d. = 0.45 Å for 288 Cα atom pairs, [Fig. 1(D)]). The total buried surface area on complex formation estimated with PISA37 is ∼1900Å2. This head-to-tail dimer is stabilized in part by extensive interactions between the β6-strand of one protomer and the α4 helix of its dimer counterpart. In addition, all strands of the six stranded β-sheet contribute to the dimer interface [Fig. 1(C)]. The geometry and amino acid composition of protein–protein interfaces can be helpful in distinguishing specific from nonspecific complexes.38 NOXclass39 analysis predicted Nup145N(443–605) to be a "biological" dimer with 99% confidence and further classified it as an obligate dimer with 71% confidence. The gap volume index (an indicator of shape complementarity within a protein-protein interface) for the Nup145N(443–605) dimer in the asymmetric unit is 3.26Å, which is less than the average value of 4.0Å observed for known obligate dimers.39 These findings prompted us to investigate the oligomerization state of Nup145N(443–605) in solution using SEC-MALLS and SAXS. Although Nup145N(443–605) eluted as an apparent monomer on the gel filtration column [Fig. 2(A)], light scattering measurements revealed a mixture of monomer and dimer species (data not shown). SAXS analyses showed: (i) the merged experimental SAXS profile matches the SAXS profile calculated for the crystallographic dimer of Nup145N(443–605) [Fig. 2(B)]; (ii) a measured radius of gyration (Rg) of 22.1 ± 0.01Å, obtained with AutoRg,40 is close to the value of 21.5Å calculated from the structure of crystallographic dimer (for reference, the calculated Rg for the Chain B monomer is 18.0Å); (iii) the "ab initio shape" reconstructed from the merged experimental SAXS profile with DAMMIF30 and GASBOR41 matches the overall shape of the Nup145N(443–605) head-to-tail dimer observed in the crystal [Fig. 2(C)]; and, (iv) based on the merged experimental SAXS profile, OLIGOMER32 estimates a dimer fraction of ∼98%. Thus, our SAXS analyses of the solution behavior of Nup145N(443–605) are consistent with the head-to-tail dimer observed in both crystal forms. A: Analytical gel filtration profile of Nup145N(443–605) at concentrations of 11.8 (black), 22.7 (blue), and 46.0 mg/ml (red) with elution times 21.5, 21.3, and 21.1 min, respectively. B: Comparison of the merged experimental SAXS profile (red) of Nup145N(443–605) with SAXS profiles computed by IMP30 for the crystallographic dimer (blue) and monomer (green) structures (inset shows the SAXS profiles across the entire measured resolution range). C: The shape of Nup145N(443–605) represented as mesh derived from the experimental SAXS profile. The yeast nucleoporins Nup100 and Nup116 arose by duplication and divergence events from a gene ancestral to Nup145, with both gene products lacking the regions homologous to Nup145C.5, 42 The solution NMR structure of yeast Nup116 (PDB Code 2AIV)43 revealed a similar overall structure to that of Nup145N(443–605) [Fig. 3(A); r.m.s.d. = 2.5Å for 117 Cα atom pairs with 32% sequence identity], although it does not appear to be a dimer in solution. The Nup116 structure revealed a remarkable conformational flexibility of the loop regions and the α4 helix (along the helical axis).40 Differences between the two structures include the conformation of loop L3, which projects toward the six stranded β-sheet in Nup145N(443–605). Loop L3 of Nup116 adopts a conformation that is intermediate between those seen in Nup145N and human Nup98 (see below). Similarly, loop L2 of Nup145N projects toward the core of the protein as compared to L2 of Nup116. These conformational differences in the loops of Nup145N and Nup116 may explain, at least in part, their differing positions within the NPC. Nup116 is found mainly on the cytoplasmic face of the NPC, whereas Nup145N is found mainly on the nuclear face.1, 3 A: Stereoview of Nup145N(443–605, green) superposed on a representative NMR structure of Nup116 (PDB Code 2AIV; gray). B: Stereoview of the Nup145N(443–605, chain B; green) superposed on Nup98-N (gray) from the Nup98-N:C-terminal fragment complex (PDB Code 2Q5Y). C: Stereoview of the dimeric association of Nup98-N in the Nup98-N:C-terminal fragment complex. The ordered C-terminal fragment tri-peptides are shown in magenta. Residues contributing to the dimer interface from the A and C chains are colored blue and orange, respectively. The N- and C-terminal residues are shown on the cartoons as blue and red spheres, respectively. Structures for the autoproteolytic domain of human Nup98 have been determined both as a Nup98-N:C-terminal fragment complex (PDB Code 2Q5Y) and as a noncleavable Ser864Ala mutant (PDB Code 2Q5X).7, 8 The structures of the Nup98-N and Nup145N(443–605) monomers are similar [Fig. 3(B); r.m.s.d. = 2.1Å for 128 Cα atom pairs with 39% sequence identity]. Noticeable differences between the two structures include some longer β-strands in the case of Nup98-N and conformations of the loops connecting the secondary structural elements. In particular, the L3 loop between β6-strand and α4-helix [residues 554–566 of Nup145N(443–605)] projects toward the protein core. Conversely, structurally equivalent residues of this loop in Nup98 project away from the protein core. The structure of the Nup98-N:C-terminal fragment complex contains two copies of the complex in the asymmetric unit. The surface area buried by association of the A and C chains of Nup98-N:C-terminal fragment complex [Fig. 2(C)] is 1147Å2 [compared with ∼1900Å2 buried within the Nup145N(443–605) dimer]. The two molecules of Nup98-N in the Nup98-N:C-terminal fragment complex associate quite differently from that seen for the Nup145N(443–605) head-to-tail dimer [Fig. 1(C)]. The α4-helix is involved in mediating extensive interactions within the dimeric interface of Nup145N(443–605). However, the α4-helix of the Nup98-N:C-terminal fragment complex, which is involved in binding to the tail peptide, contributes much less to the protein–protein interaction [Fig. 2(C)]. NOXclass37 analysis suggests that the Nup98-N dimer observed in the Nup98-N:C-terminal fragment complex crystal does not occur in nature (biological dimer <2% confidence, nonobligate dimer 68% confidence). Thus, the autoproteolytic domains of Nup98 and Nup145N associate differently in their respective crystallographic preparations. The behavior of Nup145N and Nup98 highlight the dynamic nature of NPC constituents, as they both associate with NPCs and reside within the nucleus.44 The relevance of the observed Nup145N dimer to NPC biogenesis and function is not yet clear, although SAXS analyses of Nup145N(443–605), presented herein, provide indirect support for dimer formation within the NPC and/or in the nucleus of yeast. Further biophysical and cell biological characterization of Nup145N is required to determine whether or not Nup145N and/or Nup98-N function as a dimer in vivo. Atomic coordinates and structure factors of the tetragonal and hexagonal crystal forms of Nup145N(443–605) were deposited to the PDB on 26 October 2009 with accession codes 1KEP and 1KES, respectively. The NYSGXRC target identifier for yeast Nup145 in TargetDB (http://targetdb.pdb.org) is "NYSGXRC-15145a". Expression clone sequences and selected interim experimental results are available in PepcDB (http://pepcdb.pdb.org/). The authors thank the members of the Rout and Sali laboratories for their help and advice and also grateful to Drs. John Tainer and Michal Hammel for help in using the SIBYLS beamline 12.3.1 at ALS. Use of the Advanced Photon Source was supported by the U.S. Department of Energy, Office of Basic Energy Sciences. Access to the LRL-CAT beam line facilities at Sector 31 of the APS was provided by Eli Lilly, which operates the facility.