Photooxidation of aniline and its methyl and chloro derivatives with dioxygen sensitized by substituted zinc (PcZn) and palladium (PcPd) phthalocyanines in solution and on the carrier surface upon visible light irradiation affords selectively the corresponding p-aminophenols. Active and the most stable PcPd derivative adsorbed on Amberlite XAD 7HP provides conversion of 2,6-dimethylaniline with selectivity over 90% without the loss of sensitizer activity at least in 8 repeated cycles, the overall turnover number of the sensitizer being greater than 25,000.

1 Institute of Chemical Biology and Fundamental Medicine, Siberian Division of the Russian Academy of Sciences, Lavrentyev Avenue 8, Novosibirsk 630090, Russia 2 Novosibirsk State University, Pyrogova Street 2, Novosibirsk 630090, Russia 3 Institute of Human Ecology, Sovetskii Avenue 18, Kemerovo 650099, Russia 4 Institute of Semiconductor Physics, Siberian Division of the Russian Academy of Sciences, Lavrentyev Avenue 13, Novosibirsk 630090, Russia 5 Organic Intermediates and Dyes Institute, B. Sadovaya 1/4, Moscow 103787, Russia

The catalytic reaction of crystal violet leucobase oxidation by dioxygen in o-dichlorobenzene into corresponding dye was studied as a model of hydrocarbons C–H group oxidation. Substituted iron phthalocyanines in acidic form HPcFeX were used as the catalysts. It was shown that the oxidation process was accompanied in all cases by autocatalytic destruction of catalyst with induction period depending on concentrations of reactants. The kinetics of dye formation and catalyst degradation, as well as the effect of radical reaction inhibitors were studied. The nature of the process main stages was proposed.

The highly basic non-metal octa-3,6-hexoxyphthalocyanine and its complexes with zinc and magnesium were synthesized. By reaction with trifluoroacetic acid in methylene chloride the full set of four protonated forms for nonmetal derivative and zinc complex were obtained and studied. However, only the first and the second protonated species of magnesium complex were observed because of its further demetallation. The spectral and photochemical properties of protonated phthalocyanines were thoroughly studied. The photodegradation quantum yields for non-metal octa-3,6-hexoxyphthalocyanine and its magnesium and zinc complexes in dimethylformamide were found to be of 1.10(-3), 2.6.10(-3) and 4.10(-3); singlet oxygen quantum yields - of 0.02, 0.35 and 0.53, accordingly. The drastic photostability increase and singlet oxygen generation efficacy decrease were found on each protonation step.

Expanded phthalocyanine (Pc) congeners with two Mo or W central metal ions and four isoindole ring moieties have been synthesized using normal Pc formation conditions in the presence of urea. The products have been characterized by electrochemistry; mass spectrometry (MS); IR, electron paramagnetic resonance (EPR), NMR, electronic absorption, and magnetic circular dichroism (MCD) spectroscopies; and X-ray analysis. The X-ray structures have rectangular C(2v) symmetry and provide evidence that the central Mo atoms are linked by a single bond and coordinated by two isoindole nitrogen atoms and two nitrogen atoms from the amine moieties. The electronic absorption bands extend into the 1200-1500 nm region. This can be explained using Gouterman's four-orbital theory. The experimental NMR data and theoretical calculations provide evidence for a heteroaromatic 22-π-electron conjugation system for the ring-expanded Pc system, which satisfies Hückel's (4n + 2)π aromaticity.

Purpose of this study is testing manganese and gadolinium sulpho-phthalocyanines aqueous water solutions as contrast agents for MRI. In the fields of 0,5 and 7 Tesla T1 relaxation times were measured and acceleration factors of relaxation for water aqueous solutions of proposed substances were calculated. MRI studies were having done in the field 7 Tesla in rats with C6 glioma before and after injection of proposed substances there were obtained images and T1-cards. The dynamics of tissue contrast was monitored. The measured acceleration factors of relaxation of proposed substances are comparable to the corresponding values for Magnevist TM. Reliable reduction of T1 for 1-2 hours is marked, which leads to a significant increase in signal from the tumor on T1-weighted images. In contrast to known agents drugs based on gadolinium chelates these solutions retain stay longer in the body, which allowing for more detailed MRI studies.

The spectral properties of conjugates of aluminum phthalocyanine derivatives with N-methyl-D-glucamine and Rhodamine B 2-aminoethyl ester have been studied in vivo. The introduction in phthalocyanine molecule of amino saccharide and luminophore residues was shown to be a tool to govern their properties as photosensitisers

Current work is devoted to investigation of tetra-3-phenylthio-tetra-5-t-butylphthalocyanine [(PhS)(4)(t-BU)(4)PcH2], aluminium hydroxyde tetra-3-phenylthiophthalocyanine [(PhS)(4)PcAlOH] and zinc tetra-3-phenylthiophthalocyanine [(PhS)(4)PcZn] as potential photosensitizers of near-infrared range. Investigations were performed on F, mice bearing Erlich tumor. Photosensitizers were administered intravenously in liposomal form at doses of 4-10 mg/kg. Dynamic and selectivity of sensitizers(1) accumulation in tumor were estimated in vivo from fluorescence and absorption spectra of sensitized tissue. Photosensitizers have shown high selectivity of accumulation in tumor comparing to normal tissue of mice. Maxima of selectivity for (PhS)(4)(t-BU)(4)PcH2, (PhS)(4)PcZn and (PhS)(4)PcAlOH achieve the values up to 2.5:1, 5:1 and 8:1 respectively. All photosensitizers completely clear from the normal tissue in 7-8 days. For PDT investigations tumors were irradiated using 732 nm laser with power density of 100-500 mW/cm(2) and light dose density up to 400 J/cm(2). The photodynamic efficiency was estimated using the parameter of tumor growth inhibition (TGI). All photosensitizers had shown high photodynamic efficiency of relatively large tumors. PDT using (PhS)4PcAlOH and (PhS)(4)(t-BU)(4)PcH2 caused pronounced TGI exceeding 80%. Using (PhS)4PcZn caused moderate TGI of 60%. Investigations have shown that liposomal forms of phenylthiosubstituted phthalocyanine derivatives may be used to develop new efficient photosensitizers for PDT.

Several conjugates of metallophthalocyanines with deoxyribooligonucleotides were synthesized to investigate sequence-specific modification of DNA by them. Oligonucleotide parts of these conjugates were responsible for the recognition of selected complementary sequences on the DNA target. Metallophthalocyanines were able to induce the DNA modification: phthalocyanines of Zn(II) and Al(III) were active as photosensitizers in the generation of singlet oxygen O-1(2), while phthalocyanine of Co(II) promoted DNA oxidation by molecular oxygen through the catalysis of formation of reactive oxygen species (O-center dot(2)-, H2O2, OH). Irradiation of the reaction mixture containing either Zn(II)- or Al(III)-tetracarboxyphthalocyanine conjugates of oligonucleotide pd(TCTTCCCA) with light of > 340 nm wavelength (Hg lamp or He/Ne laser) resulted in the modification of the 22-nucleotide target d(TGAATGGGAAGAGGGTCAGGTT). A conjugate of Co(II)- tetracarboxyphthalocyanine with the oligonucleotide was found to modify the DNA target in the presence of O-2 and 2-mercaptoethanol or in the presence of H2O2. Under both sensitized and catalyzed conditions, the nucleotides G(13)-G(15) were mainly modified, providing evidence that the reaction proceeded in the double-stranded oligonucleotide. These results suggest the possible use of phthalocyanine-oligonucleotide conjugates as novel artificial regulators of gene expression and therapeutic agents for treatment of cancer. Copyright (C) 2006 Alexander A. Chernonosov et al.

Di- and tri-sulfonated derivatives of metal-free phthalocyanine and Photosens have been compared in this study. In vitro phototoxicity was studied on HEp2, A549, and Colo26 cell cultures. It has been shown that phototoxicity of di- and tri- sulfonated derivatives of metal-free phthalocyanine exceeds phototoxicity of Photosens 5- and 8-times on HEp2 cell line, 8- and 6-times on A549 cell line, and 22-times on Colo26 cell line, respectively. In vivo photo-induced antitumor activity of metal-free phthalocyanine and Photosens was evaluated on mice with transplanted P388 lymphocytic leukemia. Dependence of photodynamic therapy efficiency on photosensitizer dose and time interval between preparation administration and irradiation was studied. It has been shown that Photosens is the most efficient in 5 mgikg of animal body weight dose and at 24-hour interval between injection and irradiation (tumor growth inhibition (TGI) - 82.2-95.6%). Metal-free phthalocyanine is the most efficient in 0.5 mg/kg dose which is 10- times lower than Photosens dose and when irradiated 4 hours later the injection (TGI - 78.6-100%). Metal-free di- and tri-sulfonated phthalocyanines are promising photosensitizers for photodynamic therapy. Taking into account its physical and chemical properties metal-free tri-sulfonated phthalocyanine named Phthalosens has been chosen for further thorough study.

This work is devoted to investigation of possibility to use the liposomal form of aluminium hydroxide tetra-3-phenylthiophthalocyanine as photosensitizer of near-infrared range. Aluminium hydroxide tetra-3-phenylthiophthalocyanine has shown high selectivity of accumulation in tumor comparing to normal tissue of mice as well as high photodynamic efficiency on mice bearing Erlich tumor (ELD) and lympholeucosis P-388. This compozition can be used to develop new effective photosensitizer for photodynamic therapy and fluorescent diagnostics.

technique and the device for studying of phototoxic properties of photosensitizers in vitro on cell monolayers in 96-well microplate was developed. It allows to irradiate independently each well of microtiter plate, and study simultaneously all points of dependence of phototoxic effect on the light dose for certain conditions of investigation (different concentrations of photosensitizers, different values of time of incubations of cell monolayers with photosensitizers, different time and mode of irradiation). Also it allows. to study and compare at the same conditions the dependence of phototoxic effect on the light dose for different concentrations of photosensitizer or for several photosensitizers.Developed device includes powerful source of light based arc xenon lamp with elliptical reflector, special filters and multi-fiber bundle. To determine the degree of the cell viability under the photodynamic treatment proliferative test with fluoresceinediacetate was used.Using this device and technique phototoxic action of a number of different derivatives of aluminium phthalocyanines was studied. The results of this screening have a good correlation with the results obtained in vivo on mice.

It is generally assumed that a central metal is essential for the efficiency of phthalocyanines in photodynamic therapy (PDT) of cancer. Contrary to the set opinion, the results of the present study indicate that the metal-free sulfonated phthalocyanines (H2PcSn, where n is the number of sulfonate groups per molecule) possess a considerable photoactivity. The relative phototoxicities of H2PcS1.5, H2PcS2.4, H2PcS3.1 and H2PcS3.8 on HEp2 human epidermoid carcinoma cells were 3.3, 20, 3.3 and 1, respectively, thus demonstrating dependence of the activity on the sulfonation degree, known for metallo-PcSn. A significant delay in tumor growth and a decrease in tumor regrowth rate were observed in mice after PDT with H2PcS2.4. The antitumor effect declined in the order H2PcS2.4 > H2PcS3.1 > H2PcS1.5 and vanished for H2PcS3.8. We demonstrate here that the high photodynamic activity of H2PcS2.4 can be explained by its physicochemical properties in living cells and tissues. Thus, H2PcSn (n is about 2) can be considered as a new alternative in PDT of light-accessible neoplasms and further clinic-oriented studies are warranted.

The photodynamic effects of sulphonated zinc (ZnPcS2, ZnPcS3 and ZnPcS4) and aluminum (AlPcS3) phthalocyanines as well as phosphonated aluminum phthalocyanine on the firing of isolated crayfish mechanoreceptor neurons were studied. After 30 min photosensitization neurons were irradiated with He-Ne laser (632.8 nm, 0.3 W/cm2) and changes in neuron firing frequency were recorded. Neuron firing was found to be very sensitive to photodynamic impact and served as a sensitive indicator of cell photodamage. The dynamics of the neuron responses to photodynamic effects included stages of firing activation and/or inhibition prior to irreversible firing abolition and depended on the photosensitizer type and concentration. The comparison of the dependencies of neuron lifetime on photosensitizer concentrations showed that the most effective photosensitizer was ZnPcS2. High photodynamic efficiencies of phthalocyanines was related with the weak dependence of photodynamic effect on sensitizer concentration indicating to the initiation about 3 secondary chain processes such as free radical membrane damage caused by photon absorption by one photosensitizer molecule.

It was found that irradiation of aqueous solution of aluminium sulphophthalocyanine (SnPcAl) by light with wavelength of 805 nm in the presence of sodium ascorbate results in photodynamic type I effect. S2PcAl in adsorbed state on proteins or polysaccharide structures was shown to possess rather intense long wavelength absorption band in the NIR spectral region. The comparative tests of SnPcAl with sodium ascorbate on mice with Ehrlich carcinoma and leucosis P-388 showed that photodynamic efficiency in the case of NIR irradiation (790 nm) is not loner than using visible irradiation (675 nm).

Comparative studies of oxygen consumption, surface activity, photodestruction of erythrocytes and hemoglobin were carried out during photodynamic reaction in human blood with Phthalocyanines, Chlorines, Porphyrins and Methylene blue photosensitizers in vitro.

Comparative studies of oxygen consumption, surface activity, photodestruction of erythrocytes and hemoglobin were carried out during photodynamic reaction in human blood with Phthalocyanines, Chlorines, Porphyrins and Methylene blue photosensitizers in vitro.